Incidental Mutation 'R1773:Ano3'
ID 196779
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Name anoctamin 3
Synonyms Tmem16c, B230324K02Rik
MMRRC Submission 039804-MU
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R1773 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 110655201-110950923 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 110761455 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 37 (L37R)
Ref Sequence ENSEMBL: ENSMUSP00000122387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623] [ENSMUST00000140777]
AlphaFold A2AHL1
Predicted Effect probably damaging
Transcript: ENSMUST00000099623
AA Change: L381R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: L381R

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140777
AA Change: L37R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122387
Gene: ENSMUSG00000074968
AA Change: L37R

DomainStartEndE-ValueType
Pfam:Anoctamin 40 141 5.7e-24 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,580,595 (GRCm38) K334E probably damaging Het
Abca12 A G 1: 71,288,596 (GRCm38) Y1442H probably damaging Het
Acot12 A G 13: 91,757,557 (GRCm38) T79A probably benign Het
Adipoq A C 16: 23,155,238 (GRCm38) Q26P unknown Het
Akap13 T A 7: 75,683,451 (GRCm38) N1582K possibly damaging Het
Alg9 A G 9: 50,779,096 (GRCm38) T133A probably benign Het
Anks3 T C 16: 4,947,294 (GRCm38) T418A probably benign Het
Ano9 A G 7: 141,108,378 (GRCm38) F178L possibly damaging Het
Arhgef12 A G 9: 43,005,542 (GRCm38) probably null Het
Arl16 T A 11: 120,465,763 (GRCm38) I137F possibly damaging Het
Brpf1 T A 6: 113,319,931 (GRCm38) S959T possibly damaging Het
C530008M17Rik G T 5: 76,867,205 (GRCm38) A42S possibly damaging Het
Ccdc27 C T 4: 154,041,765 (GRCm38) R89Q unknown Het
Cd109 A C 9: 78,703,724 (GRCm38) Q1207H probably benign Het
Cd14 A T 18: 36,725,304 (GRCm38) V366D possibly damaging Het
Cep290 G A 10: 100,510,573 (GRCm38) V538I probably benign Het
Cep57 G A 9: 13,816,068 (GRCm38) A202V probably damaging Het
Chl1 T C 6: 103,647,331 (GRCm38) probably null Het
Cmah T G 13: 24,417,299 (GRCm38) F29L probably benign Het
Crybg1 A G 10: 43,992,548 (GRCm38) V1378A possibly damaging Het
Cryzl2 A G 1: 157,470,722 (GRCm38) K227R probably benign Het
D130043K22Rik T G 13: 24,882,602 (GRCm38) V794G possibly damaging Het
Ddx4 T A 13: 112,599,902 (GRCm38) T645S probably benign Het
Dhcr7 C T 7: 143,847,458 (GRCm38) R453C possibly damaging Het
Dhx8 T C 11: 101,752,363 (GRCm38) Y754H possibly damaging Het
Dip2b T A 15: 100,193,961 (GRCm38) D860E probably benign Het
Dnah7a T C 1: 53,432,887 (GRCm38) probably null Het
Dst A G 1: 34,291,899 (GRCm38) D6937G probably damaging Het
Dusp1 A G 17: 26,507,107 (GRCm38) I204T probably damaging Het
Dync2h1 T A 9: 7,128,256 (GRCm38) Q1859L probably damaging Het
E4f1 C A 17: 24,446,584 (GRCm38) G328V probably damaging Het
Eml5 T C 12: 98,798,839 (GRCm38) Y1617C probably damaging Het
Espn G T 4: 152,128,229 (GRCm38) P622Q probably damaging Het
Fam184b G A 5: 45,584,334 (GRCm38) P185L possibly damaging Het
Fam71f1 T C 6: 29,334,153 (GRCm38) S335P possibly damaging Het
Fn1 T A 1: 71,637,383 (GRCm38) D563V probably damaging Het
Gad2 A G 2: 22,690,207 (GRCm38) Y540C probably benign Het
Gdf11 T C 10: 128,891,294 (GRCm38) D131G probably damaging Het
Gm19965 T A 1: 116,821,259 (GRCm38) Y223* probably null Het
H2-M10.6 A G 17: 36,812,184 (GRCm38) K3R probably benign Het
Hid1 A G 11: 115,348,510 (GRCm38) Y776H probably damaging Het
Hivep3 A T 4: 120,098,837 (GRCm38) K1450I probably damaging Het
Icam5 T C 9: 21,033,525 (GRCm38) L128P possibly damaging Het
Idnk T C 13: 58,157,712 (GRCm38) V9A probably damaging Het
Il4ra A T 7: 125,567,182 (GRCm38) T33S possibly damaging Het
Ino80 A G 2: 119,418,409 (GRCm38) V990A probably benign Het
Krtap4-9 T C 11: 99,785,570 (GRCm38) probably benign Het
Lrrk2 A G 15: 91,779,981 (GRCm38) I1974V possibly damaging Het
Mcm3ap C T 10: 76,471,160 (GRCm38) A369V probably benign Het
Nek6 A G 2: 38,582,419 (GRCm38) M252V probably benign Het
Nfasc T A 1: 132,610,839 (GRCm38) I443F probably damaging Het
Nme8 T G 13: 19,697,036 (GRCm38) M1L probably damaging Het
Npnt T A 3: 132,904,693 (GRCm38) Q423L possibly damaging Het
Nup133 A T 8: 123,930,983 (GRCm38) C404* probably null Het
Olfr1232 A G 2: 89,325,742 (GRCm38) V146A probably benign Het
Olfr1307 A G 2: 111,944,859 (GRCm38) V199A possibly damaging Het
Olfr1535 T C 13: 21,555,812 (GRCm38) D70G probably damaging Het
Olfr262 T C 19: 12,241,659 (GRCm38) M1V probably null Het
Olfr684 T C 7: 105,156,983 (GRCm38) E233G probably benign Het
Olfr806 A G 10: 129,738,443 (GRCm38) L158S probably damaging Het
Otog T A 7: 46,288,159 (GRCm38) I1764N probably benign Het
Oxa1l A G 14: 54,363,452 (GRCm38) I127M probably benign Het
P4hb C A 11: 120,572,726 (GRCm38) V28F probably damaging Het
Pbld2 C T 10: 63,054,371 (GRCm38) A186V probably benign Het
Pdzph1 G T 17: 58,974,813 (GRCm38) T158K probably damaging Het
Pgm1 T A 5: 64,107,851 (GRCm38) probably null Het
Phip A T 9: 82,876,189 (GRCm38) S1484T probably benign Het
Pikfyve T C 1: 65,246,370 (GRCm38) S923P probably benign Het
Pikfyve T C 1: 65,192,271 (GRCm38) L100P probably damaging Het
Pla2g4e A G 2: 120,244,721 (GRCm38) S63P probably benign Het
Plekhh2 A G 17: 84,599,265 (GRCm38) E1176G probably damaging Het
Prlr T A 15: 10,325,318 (GRCm38) Y192* probably null Het
Pten T A 19: 32,798,072 (GRCm38) C71S probably damaging Het
Rbbp8nl A G 2: 180,281,194 (GRCm38) L202P probably benign Het
Ripor2 T A 13: 24,701,254 (GRCm38) S491T probably benign Het
Robo1 A T 16: 73,004,511 (GRCm38) I1008F probably benign Het
Scg2 T C 1: 79,435,635 (GRCm38) N417S probably benign Het
Scn8a A G 15: 101,039,615 (GRCm38) I1581V probably damaging Het
Slc22a8 T A 19: 8,594,229 (GRCm38) I108N probably damaging Het
Slc9a8 A T 2: 167,471,465 (GRCm38) T416S possibly damaging Het
Spata32 T A 11: 103,208,818 (GRCm38) E287V probably damaging Het
Spata5 T C 3: 37,439,185 (GRCm38) F515L probably damaging Het
Tgfbrap1 C T 1: 43,075,352 (GRCm38) G196D probably damaging Het
Tgm5 G T 2: 121,077,650 (GRCm38) T15K possibly damaging Het
Tmc1 C T 19: 20,826,501 (GRCm38) probably null Het
Tmem177 T C 1: 119,910,576 (GRCm38) I124M possibly damaging Het
Trim30a A G 7: 104,435,901 (GRCm38) F34S probably damaging Het
Tsn T C 1: 118,305,239 (GRCm38) T112A probably benign Het
Tspyl5 T G 15: 33,686,776 (GRCm38) N341T probably benign Het
Vmn2r108 C T 17: 20,469,073 (GRCm38) C540Y probably damaging Het
Vrtn C T 12: 84,650,224 (GRCm38) R583W probably damaging Het
Wnt1 T C 15: 98,791,757 (GRCm38) S142P probably damaging Het
Wrn A T 8: 33,343,561 (GRCm38) I108N probably damaging Het
Zfhx2 A C 14: 55,072,891 (GRCm38) C733G possibly damaging Het
Zfp219 T C 14: 52,007,106 (GRCm38) T539A probably damaging Het
Zswim8 T A 14: 20,711,530 (GRCm38) M177K probably damaging Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110,771,050 (GRCm38) splice site probably benign
IGL01066:Ano3 APN 2 110,661,445 (GRCm38) missense probably null 0.00
IGL01696:Ano3 APN 2 110,667,737 (GRCm38) missense probably damaging 1.00
IGL01729:Ano3 APN 2 110,781,394 (GRCm38) splice site probably null
IGL01785:Ano3 APN 2 110,682,715 (GRCm38) missense probably damaging 1.00
IGL01786:Ano3 APN 2 110,682,715 (GRCm38) missense probably damaging 1.00
IGL01992:Ano3 APN 2 110,658,219 (GRCm38) missense probably damaging 1.00
IGL02098:Ano3 APN 2 110,666,441 (GRCm38) nonsense probably null
IGL02333:Ano3 APN 2 110,697,199 (GRCm38) splice site probably benign
IGL02346:Ano3 APN 2 110,770,926 (GRCm38) splice site probably benign
IGL02352:Ano3 APN 2 110,884,943 (GRCm38) nonsense probably null
IGL02359:Ano3 APN 2 110,884,943 (GRCm38) nonsense probably null
IGL02544:Ano3 APN 2 110,658,249 (GRCm38) missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110,665,984 (GRCm38) splice site probably benign
IGL02861:Ano3 APN 2 110,738,812 (GRCm38) missense probably damaging 1.00
IGL02948:Ano3 APN 2 110,697,018 (GRCm38) splice site probably benign
IGL03327:Ano3 APN 2 110,697,178 (GRCm38) missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110,697,124 (GRCm38) missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110,775,010 (GRCm38) missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110,697,418 (GRCm38) missense probably damaging 1.00
R0349:Ano3 UTSW 2 110,661,487 (GRCm38) missense probably damaging 1.00
R0426:Ano3 UTSW 2 110,661,174 (GRCm38) missense probably damaging 1.00
R0523:Ano3 UTSW 2 110,884,855 (GRCm38) missense probably benign 0.13
R0557:Ano3 UTSW 2 110,862,952 (GRCm38) splice site probably null
R0611:Ano3 UTSW 2 110,885,001 (GRCm38) missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110,697,976 (GRCm38) missense probably benign 0.03
R1459:Ano3 UTSW 2 110,880,829 (GRCm38) missense probably benign 0.00
R1460:Ano3 UTSW 2 110,682,758 (GRCm38) missense probably damaging 0.97
R1874:Ano3 UTSW 2 110,884,872 (GRCm38) missense probably benign 0.00
R1919:Ano3 UTSW 2 110,885,007 (GRCm38) missense probably benign
R2185:Ano3 UTSW 2 110,775,045 (GRCm38) missense probably benign 0.01
R2280:Ano3 UTSW 2 110,682,759 (GRCm38) missense probably benign 0.22
R2281:Ano3 UTSW 2 110,682,759 (GRCm38) missense probably benign 0.22
R2348:Ano3 UTSW 2 110,783,743 (GRCm38) missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110,862,843 (GRCm38) missense probably benign
R2697:Ano3 UTSW 2 110,794,960 (GRCm38) missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110,885,000 (GRCm38) missense probably damaging 0.99
R3923:Ano3 UTSW 2 110,770,959 (GRCm38) missense probably damaging 1.00
R4352:Ano3 UTSW 2 110,745,894 (GRCm38) missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110,761,578 (GRCm38) splice site probably null
R4790:Ano3 UTSW 2 110,884,919 (GRCm38) missense probably benign
R4832:Ano3 UTSW 2 110,667,722 (GRCm38) missense probably damaging 1.00
R4916:Ano3 UTSW 2 110,771,020 (GRCm38) missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110,661,480 (GRCm38) missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110,745,870 (GRCm38) missense probably damaging 1.00
R5498:Ano3 UTSW 2 110,697,103 (GRCm38) missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110,884,995 (GRCm38) missense probably damaging 0.99
R5627:Ano3 UTSW 2 110,756,953 (GRCm38) missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110,658,273 (GRCm38) missense probably benign 0.11
R5767:Ano3 UTSW 2 110,661,271 (GRCm38) missense probably damaging 1.00
R5883:Ano3 UTSW 2 110,880,864 (GRCm38) missense probably null 0.15
R5899:Ano3 UTSW 2 110,862,887 (GRCm38) missense probably benign 0.39
R5916:Ano3 UTSW 2 110,681,836 (GRCm38) missense probably benign 0.29
R6158:Ano3 UTSW 2 110,665,875 (GRCm38) missense probably damaging 1.00
R6315:Ano3 UTSW 2 110,697,039 (GRCm38) missense probably damaging 1.00
R6401:Ano3 UTSW 2 110,775,114 (GRCm38) missense probably benign 0.01
R6481:Ano3 UTSW 2 110,795,027 (GRCm38) missense probably benign 0.16
R6482:Ano3 UTSW 2 110,697,055 (GRCm38) missense probably damaging 1.00
R6587:Ano3 UTSW 2 110,797,904 (GRCm38) splice site probably null
R6811:Ano3 UTSW 2 110,880,867 (GRCm38) missense probably benign 0.03
R7048:Ano3 UTSW 2 110,682,771 (GRCm38) nonsense probably null
R7145:Ano3 UTSW 2 110,862,860 (GRCm38) missense probably benign 0.31
R7207:Ano3 UTSW 2 110,781,423 (GRCm38) missense probably damaging 0.96
R7215:Ano3 UTSW 2 110,665,932 (GRCm38) missense probably damaging 1.00
R7366:Ano3 UTSW 2 110,757,067 (GRCm38) missense probably damaging 1.00
R7371:Ano3 UTSW 2 110,884,849 (GRCm38) critical splice donor site probably null
R7568:Ano3 UTSW 2 110,950,293 (GRCm38) start gained probably benign
R7636:Ano3 UTSW 2 110,682,703 (GRCm38) nonsense probably null
R7888:Ano3 UTSW 2 110,666,428 (GRCm38) missense probably damaging 1.00
R7992:Ano3 UTSW 2 110,775,022 (GRCm38) missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110,667,783 (GRCm38) missense probably damaging 0.99
R8074:Ano3 UTSW 2 110,950,232 (GRCm38) start gained probably benign
R8111:Ano3 UTSW 2 110,783,713 (GRCm38) missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110,666,456 (GRCm38) missense probably damaging 1.00
R8297:Ano3 UTSW 2 110,661,271 (GRCm38) missense probably damaging 1.00
R8485:Ano3 UTSW 2 110,667,855 (GRCm38) critical splice acceptor site probably null
R8509:Ano3 UTSW 2 110,665,835 (GRCm38) missense possibly damaging 0.50
R8870:Ano3 UTSW 2 110,783,729 (GRCm38) missense probably benign 0.12
R9071:Ano3 UTSW 2 110,795,073 (GRCm38) critical splice acceptor site probably null
R9072:Ano3 UTSW 2 110,745,898 (GRCm38) missense probably benign 0.06
R9073:Ano3 UTSW 2 110,745,898 (GRCm38) missense probably benign 0.06
R9315:Ano3 UTSW 2 110,697,942 (GRCm38) missense probably damaging 0.97
R9376:Ano3 UTSW 2 110,666,437 (GRCm38) missense probably damaging 1.00
R9588:Ano3 UTSW 2 110,697,997 (GRCm38) missense possibly damaging 0.91
R9697:Ano3 UTSW 2 110,665,908 (GRCm38) missense probably damaging 1.00
R9716:Ano3 UTSW 2 110,771,031 (GRCm38) missense probably damaging 0.97
R9748:Ano3 UTSW 2 110,658,295 (GRCm38) missense probably damaging 1.00
RF012:Ano3 UTSW 2 110,697,523 (GRCm38) missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110,697,036 (GRCm38) missense probably benign 0.30
X0058:Ano3 UTSW 2 110,697,418 (GRCm38) missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110,745,847 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACTTCCACACACTGAGTTTC -3'
(R):5'- CCGTTGACAATGGCATTCACCATTC -3'

Sequencing Primer
(F):5'- CTTCCCTTGAAGAATCATGTAGTG -3'
(R):5'- GACAATGGCATTCACCATTCTAGTG -3'
Posted On 2014-05-23