Incidental Mutation 'R1773:Akap13'
ID 196810
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene Name A kinase (PRKA) anchor protein 13
Synonyms AKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik
MMRRC Submission 039804-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1773 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 75455534-75754609 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75683451 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1582 (N1582K)
Ref Sequence ENSEMBL: ENSMUSP00000147237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750] [ENSMUST00000207923]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000147005
AA Change: N1582K

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: N1582K

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
internal_repeat_1 485 695 4.85e-5 PROSPERO
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
Pfam:RII_binding_1 1218 1235 4.3e-6 PFAM
low complexity region 1429 1444 N/A INTRINSIC
low complexity region 1479 1501 N/A INTRINSIC
low complexity region 1601 1612 N/A INTRINSIC
low complexity region 1738 1768 N/A INTRINSIC
C1 1773 1819 1.95e-4 SMART
low complexity region 1876 1887 N/A INTRINSIC
RhoGEF 1979 2171 1.28e-61 SMART
PH 2213 2316 2.94e-11 SMART
coiled coil region 2326 2363 N/A INTRINSIC
low complexity region 2411 2430 N/A INTRINSIC
low complexity region 2462 2472 N/A INTRINSIC
coiled coil region 2551 2664 N/A INTRINSIC
low complexity region 2746 2752 N/A INTRINSIC
low complexity region 2758 2771 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166315
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207750
AA Change: N1582K

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000207923
Predicted Effect probably benign
Transcript: ENSMUST00000207998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208456
Predicted Effect unknown
Transcript: ENSMUST00000208708
AA Change: N406K
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,580,595 (GRCm38) K334E probably damaging Het
Abca12 A G 1: 71,288,596 (GRCm38) Y1442H probably damaging Het
Acot12 A G 13: 91,757,557 (GRCm38) T79A probably benign Het
Adipoq A C 16: 23,155,238 (GRCm38) Q26P unknown Het
Alg9 A G 9: 50,779,096 (GRCm38) T133A probably benign Het
Anks3 T C 16: 4,947,294 (GRCm38) T418A probably benign Het
Ano3 A C 2: 110,761,455 (GRCm38) L37R probably damaging Het
Ano9 A G 7: 141,108,378 (GRCm38) F178L possibly damaging Het
Arhgef12 A G 9: 43,005,542 (GRCm38) probably null Het
Arl16 T A 11: 120,465,763 (GRCm38) I137F possibly damaging Het
Brpf1 T A 6: 113,319,931 (GRCm38) S959T possibly damaging Het
C530008M17Rik G T 5: 76,867,205 (GRCm38) A42S possibly damaging Het
Ccdc27 C T 4: 154,041,765 (GRCm38) R89Q unknown Het
Cd109 A C 9: 78,703,724 (GRCm38) Q1207H probably benign Het
Cd14 A T 18: 36,725,304 (GRCm38) V366D possibly damaging Het
Cep290 G A 10: 100,510,573 (GRCm38) V538I probably benign Het
Cep57 G A 9: 13,816,068 (GRCm38) A202V probably damaging Het
Chl1 T C 6: 103,647,331 (GRCm38) probably null Het
Cmah T G 13: 24,417,299 (GRCm38) F29L probably benign Het
Crybg1 A G 10: 43,992,548 (GRCm38) V1378A possibly damaging Het
Cryzl2 A G 1: 157,470,722 (GRCm38) K227R probably benign Het
D130043K22Rik T G 13: 24,882,602 (GRCm38) V794G possibly damaging Het
Ddx4 T A 13: 112,599,902 (GRCm38) T645S probably benign Het
Dhcr7 C T 7: 143,847,458 (GRCm38) R453C possibly damaging Het
Dhx8 T C 11: 101,752,363 (GRCm38) Y754H possibly damaging Het
Dip2b T A 15: 100,193,961 (GRCm38) D860E probably benign Het
Dnah7a T C 1: 53,432,887 (GRCm38) probably null Het
Dst A G 1: 34,291,899 (GRCm38) D6937G probably damaging Het
Dusp1 A G 17: 26,507,107 (GRCm38) I204T probably damaging Het
Dync2h1 T A 9: 7,128,256 (GRCm38) Q1859L probably damaging Het
E4f1 C A 17: 24,446,584 (GRCm38) G328V probably damaging Het
Eml5 T C 12: 98,798,839 (GRCm38) Y1617C probably damaging Het
Espn G T 4: 152,128,229 (GRCm38) P622Q probably damaging Het
Fam184b G A 5: 45,584,334 (GRCm38) P185L possibly damaging Het
Fam71f1 T C 6: 29,334,153 (GRCm38) S335P possibly damaging Het
Fn1 T A 1: 71,637,383 (GRCm38) D563V probably damaging Het
Gad2 A G 2: 22,690,207 (GRCm38) Y540C probably benign Het
Gdf11 T C 10: 128,891,294 (GRCm38) D131G probably damaging Het
Gm19965 T A 1: 116,821,259 (GRCm38) Y223* probably null Het
H2-M10.6 A G 17: 36,812,184 (GRCm38) K3R probably benign Het
Hid1 A G 11: 115,348,510 (GRCm38) Y776H probably damaging Het
Hivep3 A T 4: 120,098,837 (GRCm38) K1450I probably damaging Het
Icam5 T C 9: 21,033,525 (GRCm38) L128P possibly damaging Het
Idnk T C 13: 58,157,712 (GRCm38) V9A probably damaging Het
Il4ra A T 7: 125,567,182 (GRCm38) T33S possibly damaging Het
Ino80 A G 2: 119,418,409 (GRCm38) V990A probably benign Het
Krtap4-9 T C 11: 99,785,570 (GRCm38) probably benign Het
Lrrk2 A G 15: 91,779,981 (GRCm38) I1974V possibly damaging Het
Mcm3ap C T 10: 76,471,160 (GRCm38) A369V probably benign Het
Nek6 A G 2: 38,582,419 (GRCm38) M252V probably benign Het
Nfasc T A 1: 132,610,839 (GRCm38) I443F probably damaging Het
Nme8 T G 13: 19,697,036 (GRCm38) M1L probably damaging Het
Npnt T A 3: 132,904,693 (GRCm38) Q423L possibly damaging Het
Nup133 A T 8: 123,930,983 (GRCm38) C404* probably null Het
Olfr1232 A G 2: 89,325,742 (GRCm38) V146A probably benign Het
Olfr1307 A G 2: 111,944,859 (GRCm38) V199A possibly damaging Het
Olfr1535 T C 13: 21,555,812 (GRCm38) D70G probably damaging Het
Olfr262 T C 19: 12,241,659 (GRCm38) M1V probably null Het
Olfr684 T C 7: 105,156,983 (GRCm38) E233G probably benign Het
Olfr806 A G 10: 129,738,443 (GRCm38) L158S probably damaging Het
Otog T A 7: 46,288,159 (GRCm38) I1764N probably benign Het
Oxa1l A G 14: 54,363,452 (GRCm38) I127M probably benign Het
P4hb C A 11: 120,572,726 (GRCm38) V28F probably damaging Het
Pbld2 C T 10: 63,054,371 (GRCm38) A186V probably benign Het
Pdzph1 G T 17: 58,974,813 (GRCm38) T158K probably damaging Het
Pgm1 T A 5: 64,107,851 (GRCm38) probably null Het
Phip A T 9: 82,876,189 (GRCm38) S1484T probably benign Het
Pikfyve T C 1: 65,246,370 (GRCm38) S923P probably benign Het
Pikfyve T C 1: 65,192,271 (GRCm38) L100P probably damaging Het
Pla2g4e A G 2: 120,244,721 (GRCm38) S63P probably benign Het
Plekhh2 A G 17: 84,599,265 (GRCm38) E1176G probably damaging Het
Prlr T A 15: 10,325,318 (GRCm38) Y192* probably null Het
Pten T A 19: 32,798,072 (GRCm38) C71S probably damaging Het
Rbbp8nl A G 2: 180,281,194 (GRCm38) L202P probably benign Het
Ripor2 T A 13: 24,701,254 (GRCm38) S491T probably benign Het
Robo1 A T 16: 73,004,511 (GRCm38) I1008F probably benign Het
Scg2 T C 1: 79,435,635 (GRCm38) N417S probably benign Het
Scn8a A G 15: 101,039,615 (GRCm38) I1581V probably damaging Het
Slc22a8 T A 19: 8,594,229 (GRCm38) I108N probably damaging Het
Slc9a8 A T 2: 167,471,465 (GRCm38) T416S possibly damaging Het
Spata32 T A 11: 103,208,818 (GRCm38) E287V probably damaging Het
Spata5 T C 3: 37,439,185 (GRCm38) F515L probably damaging Het
Tgfbrap1 C T 1: 43,075,352 (GRCm38) G196D probably damaging Het
Tgm5 G T 2: 121,077,650 (GRCm38) T15K possibly damaging Het
Tmc1 C T 19: 20,826,501 (GRCm38) probably null Het
Tmem177 T C 1: 119,910,576 (GRCm38) I124M possibly damaging Het
Trim30a A G 7: 104,435,901 (GRCm38) F34S probably damaging Het
Tsn T C 1: 118,305,239 (GRCm38) T112A probably benign Het
Tspyl5 T G 15: 33,686,776 (GRCm38) N341T probably benign Het
Vmn2r108 C T 17: 20,469,073 (GRCm38) C540Y probably damaging Het
Vrtn C T 12: 84,650,224 (GRCm38) R583W probably damaging Het
Wnt1 T C 15: 98,791,757 (GRCm38) S142P probably damaging Het
Wrn A T 8: 33,343,561 (GRCm38) I108N probably damaging Het
Zfhx2 A C 14: 55,072,891 (GRCm38) C733G possibly damaging Het
Zfp219 T C 14: 52,007,106 (GRCm38) T539A probably damaging Het
Zswim8 T A 14: 20,711,530 (GRCm38) M177K probably damaging Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75,725,971 (GRCm38) missense probably damaging 0.99
IGL00332:Akap13 APN 7 75,728,919 (GRCm38) missense probably damaging 1.00
IGL00481:Akap13 APN 7 75,723,895 (GRCm38) missense probably damaging 1.00
IGL00590:Akap13 APN 7 75,610,669 (GRCm38) missense probably benign 0.01
IGL00655:Akap13 APN 7 75,704,398 (GRCm38) missense probably damaging 0.99
IGL00766:Akap13 APN 7 75,704,512 (GRCm38) missense probably damaging 0.96
IGL00818:Akap13 APN 7 75,609,727 (GRCm38) missense probably benign 0.00
IGL00826:Akap13 APN 7 75,677,447 (GRCm38) missense probably damaging 1.00
IGL01014:Akap13 APN 7 75,750,633 (GRCm38) utr 3 prime probably benign
IGL01090:Akap13 APN 7 75,666,531 (GRCm38) missense probably benign 0.44
IGL01155:Akap13 APN 7 75,569,936 (GRCm38) missense probably damaging 1.00
IGL01326:Akap13 APN 7 75,725,348 (GRCm38) missense probably benign 0.30
IGL01456:Akap13 APN 7 75,602,847 (GRCm38) missense probably damaging 0.98
IGL01460:Akap13 APN 7 75,747,846 (GRCm38) missense probably benign 0.29
IGL01568:Akap13 APN 7 75,608,522 (GRCm38) nonsense probably null 0.00
IGL01610:Akap13 APN 7 75,747,605 (GRCm38) missense probably damaging 1.00
IGL01610:Akap13 APN 7 75,720,180 (GRCm38) missense possibly damaging 0.71
IGL01615:Akap13 APN 7 75,697,393 (GRCm38) missense probably damaging 1.00
IGL01667:Akap13 APN 7 75,570,019 (GRCm38) missense probably damaging 1.00
IGL01705:Akap13 APN 7 75,746,767 (GRCm38) missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75,666,545 (GRCm38) missense probably benign 0.27
IGL02269:Akap13 APN 7 75,602,911 (GRCm38) missense probably benign
IGL02421:Akap13 APN 7 75,717,806 (GRCm38) missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75,609,188 (GRCm38) missense probably damaging 0.96
IGL02944:Akap13 APN 7 75,608,657 (GRCm38) missense probably benign
IGL03051:Akap13 APN 7 75,610,485 (GRCm38) nonsense probably null
IGL03160:Akap13 APN 7 75,730,417 (GRCm38) missense probably damaging 1.00
IGL03245:Akap13 APN 7 75,609,752 (GRCm38) missense probably damaging 0.99
R0254:Akap13 UTSW 7 75,736,604 (GRCm38) splice site probably benign
R0310:Akap13 UTSW 7 75,614,930 (GRCm38) missense probably damaging 0.99
R0373:Akap13 UTSW 7 75,730,500 (GRCm38) missense probably damaging 1.00
R0373:Akap13 UTSW 7 75,609,929 (GRCm38) missense probably benign 0.00
R0408:Akap13 UTSW 7 75,746,796 (GRCm38) missense probably damaging 1.00
R0631:Akap13 UTSW 7 75,614,996 (GRCm38) missense probably damaging 0.99
R0646:Akap13 UTSW 7 75,747,746 (GRCm38) missense probably damaging 1.00
R0781:Akap13 UTSW 7 75,611,377 (GRCm38) missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75,725,380 (GRCm38) missense probably damaging 1.00
R1004:Akap13 UTSW 7 75,687,286 (GRCm38) missense probably damaging 0.99
R1024:Akap13 UTSW 7 75,677,409 (GRCm38) missense probably damaging 1.00
R1110:Akap13 UTSW 7 75,611,377 (GRCm38) missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75,609,592 (GRCm38) missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75,609,592 (GRCm38) missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75,609,592 (GRCm38) missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75,586,193 (GRCm38) missense probably damaging 0.97
R1442:Akap13 UTSW 7 75,735,778 (GRCm38) missense probably damaging 0.99
R1466:Akap13 UTSW 7 75,729,049 (GRCm38) missense possibly damaging 0.79
R1466:Akap13 UTSW 7 75,729,049 (GRCm38) missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75,729,049 (GRCm38) missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75,609,592 (GRCm38) missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75,677,194 (GRCm38) missense probably damaging 1.00
R1785:Akap13 UTSW 7 75,611,434 (GRCm38) missense probably benign 0.16
R1786:Akap13 UTSW 7 75,611,434 (GRCm38) missense probably benign 0.16
R1791:Akap13 UTSW 7 75,611,035 (GRCm38) missense probably benign 0.00
R1819:Akap13 UTSW 7 75,608,705 (GRCm38) missense probably benign 0.04
R1879:Akap13 UTSW 7 75,610,727 (GRCm38) missense probably benign 0.01
R1989:Akap13 UTSW 7 75,704,516 (GRCm38) missense probably benign 0.01
R2016:Akap13 UTSW 7 75,704,531 (GRCm38) missense probably damaging 0.99
R2092:Akap13 UTSW 7 75,610,570 (GRCm38) missense probably benign 0.05
R2126:Akap13 UTSW 7 75,725,304 (GRCm38) missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75,611,434 (GRCm38) missense probably benign 0.16
R2132:Akap13 UTSW 7 75,611,434 (GRCm38) missense probably benign 0.16
R2133:Akap13 UTSW 7 75,611,434 (GRCm38) missense probably benign 0.16
R2251:Akap13 UTSW 7 75,739,477 (GRCm38) missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75,666,550 (GRCm38) missense probably damaging 1.00
R3713:Akap13 UTSW 7 75,586,181 (GRCm38) missense probably damaging 0.98
R3731:Akap13 UTSW 7 75,611,377 (GRCm38) missense probably benign 0.39
R3765:Akap13 UTSW 7 75,608,837 (GRCm38) missense probably benign 0.04
R3788:Akap13 UTSW 7 75,702,153 (GRCm38) critical splice donor site probably null
R3793:Akap13 UTSW 7 75,610,141 (GRCm38) missense probably benign 0.00
R3970:Akap13 UTSW 7 75,569,951 (GRCm38) nonsense probably null
R4205:Akap13 UTSW 7 75,610,919 (GRCm38) missense probably benign 0.05
R4257:Akap13 UTSW 7 75,611,285 (GRCm38) missense probably damaging 0.98
R4374:Akap13 UTSW 7 75,608,984 (GRCm38) missense probably damaging 0.96
R4448:Akap13 UTSW 7 75,742,760 (GRCm38) missense probably damaging 1.00
R4450:Akap13 UTSW 7 75,742,760 (GRCm38) missense probably damaging 1.00
R4457:Akap13 UTSW 7 75,739,465 (GRCm38) missense probably damaging 0.99
R4458:Akap13 UTSW 7 75,739,465 (GRCm38) missense probably damaging 0.99
R4466:Akap13 UTSW 7 75,602,773 (GRCm38) splice site probably null
R4632:Akap13 UTSW 7 75,666,553 (GRCm38) missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75,729,094 (GRCm38) missense probably damaging 1.00
R4669:Akap13 UTSW 7 75,729,094 (GRCm38) missense probably damaging 1.00
R4671:Akap13 UTSW 7 75,579,564 (GRCm38) nonsense probably null
R4821:Akap13 UTSW 7 75,677,507 (GRCm38) intron probably benign
R4868:Akap13 UTSW 7 75,743,504 (GRCm38) missense probably damaging 1.00
R4894:Akap13 UTSW 7 75,725,320 (GRCm38) missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75,749,240 (GRCm38) missense probably benign 0.22
R4962:Akap13 UTSW 7 75,749,430 (GRCm38) missense probably damaging 0.98
R4988:Akap13 UTSW 7 75,730,528 (GRCm38) missense probably damaging 1.00
R5119:Akap13 UTSW 7 75,687,252 (GRCm38) missense probably damaging 0.98
R5141:Akap13 UTSW 7 75,609,614 (GRCm38) missense probably benign 0.18
R5419:Akap13 UTSW 7 75,610,243 (GRCm38) missense probably benign 0.01
R5427:Akap13 UTSW 7 75,728,869 (GRCm38) missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75,602,904 (GRCm38) missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75,602,830 (GRCm38) missense probably damaging 1.00
R5458:Akap13 UTSW 7 75,586,301 (GRCm38) missense probably damaging 1.00
R5636:Akap13 UTSW 7 75,704,372 (GRCm38) missense probably damaging 0.96
R5643:Akap13 UTSW 7 75,702,154 (GRCm38) critical splice donor site probably null
R5898:Akap13 UTSW 7 75,729,146 (GRCm38) missense probably damaging 1.00
R5932:Akap13 UTSW 7 75,610,184 (GRCm38) missense probably damaging 1.00
R6135:Akap13 UTSW 7 75,609,908 (GRCm38) missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75,677,416 (GRCm38) missense probably damaging 1.00
R6182:Akap13 UTSW 7 75,586,280 (GRCm38) missense probably benign 0.45
R6310:Akap13 UTSW 7 75,749,193 (GRCm38) missense probably damaging 0.99
R6346:Akap13 UTSW 7 75,685,254 (GRCm38) missense probably damaging 1.00
R6466:Akap13 UTSW 7 75,727,044 (GRCm38) missense probably benign 0.01
R6605:Akap13 UTSW 7 75,579,768 (GRCm38) missense probably damaging 0.98
R6617:Akap13 UTSW 7 75,730,363 (GRCm38) missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75,569,981 (GRCm38) missense probably damaging 1.00
R6703:Akap13 UTSW 7 75,602,898 (GRCm38) missense probably damaging 1.00
R6750:Akap13 UTSW 7 75,739,458 (GRCm38) missense probably benign 0.03
R7069:Akap13 UTSW 7 75,610,262 (GRCm38) missense probably benign 0.29
R7116:Akap13 UTSW 7 75,720,195 (GRCm38) missense probably benign 0.00
R7158:Akap13 UTSW 7 75,579,594 (GRCm38) missense probably damaging 0.97
R7159:Akap13 UTSW 7 75,730,579 (GRCm38) missense possibly damaging 0.72
R7467:Akap13 UTSW 7 75,730,465 (GRCm38) missense probably damaging 1.00
R7468:Akap13 UTSW 7 75,730,465 (GRCm38) missense probably damaging 1.00
R7471:Akap13 UTSW 7 75,730,465 (GRCm38) missense probably damaging 1.00
R7472:Akap13 UTSW 7 75,730,465 (GRCm38) missense probably damaging 1.00
R7477:Akap13 UTSW 7 75,749,247 (GRCm38) missense probably benign
R7636:Akap13 UTSW 7 75,609,873 (GRCm38) missense probably benign 0.04
R7650:Akap13 UTSW 7 75,643,454 (GRCm38) missense probably benign 0.20
R7671:Akap13 UTSW 7 75,569,900 (GRCm38) missense probably damaging 1.00
R7681:Akap13 UTSW 7 75,728,796 (GRCm38) missense possibly damaging 0.91
R7752:Akap13 UTSW 7 75,677,258 (GRCm38) missense possibly damaging 0.74
R7784:Akap13 UTSW 7 75,610,328 (GRCm38) missense probably benign 0.00
R7816:Akap13 UTSW 7 75,730,465 (GRCm38) missense probably damaging 1.00
R7817:Akap13 UTSW 7 75,730,465 (GRCm38) missense probably damaging 1.00
R7834:Akap13 UTSW 7 75,742,642 (GRCm38) missense possibly damaging 0.85
R7880:Akap13 UTSW 7 75,586,216 (GRCm38) missense probably damaging 0.97
R7942:Akap13 UTSW 7 75,611,470 (GRCm38) missense possibly damaging 0.50
R8006:Akap13 UTSW 7 75,579,696 (GRCm38) missense probably damaging 1.00
R8009:Akap13 UTSW 7 75,730,465 (GRCm38) missense probably damaging 1.00
R8011:Akap13 UTSW 7 75,730,465 (GRCm38) missense probably damaging 1.00
R8012:Akap13 UTSW 7 75,730,465 (GRCm38) missense probably damaging 1.00
R8013:Akap13 UTSW 7 75,730,465 (GRCm38) missense probably damaging 1.00
R8016:Akap13 UTSW 7 75,730,465 (GRCm38) missense probably damaging 1.00
R8089:Akap13 UTSW 7 75,610,592 (GRCm38) missense possibly damaging 0.94
R8138:Akap13 UTSW 7 75,702,231 (GRCm38) splice site probably null
R8174:Akap13 UTSW 7 75,728,869 (GRCm38) missense possibly damaging 0.89
R8298:Akap13 UTSW 7 75,747,804 (GRCm38) missense probably damaging 1.00
R8444:Akap13 UTSW 7 75,730,465 (GRCm38) missense probably damaging 1.00
R8445:Akap13 UTSW 7 75,730,465 (GRCm38) missense probably damaging 1.00
R8465:Akap13 UTSW 7 75,727,038 (GRCm38) missense probably benign 0.11
R8512:Akap13 UTSW 7 75,611,086 (GRCm38) missense probably damaging 0.99
R8523:Akap13 UTSW 7 75,730,465 (GRCm38) missense probably damaging 1.00
R8793:Akap13 UTSW 7 75,725,328 (GRCm38) missense probably benign 0.35
R8907:Akap13 UTSW 7 75,610,708 (GRCm38) missense probably damaging 0.99
R8907:Akap13 UTSW 7 75,610,696 (GRCm38) missense probably benign 0.08
R8928:Akap13 UTSW 7 75,609,858 (GRCm38) missense probably benign 0.00
R8929:Akap13 UTSW 7 75,609,004 (GRCm38) missense probably benign 0.00
R8937:Akap13 UTSW 7 75,534,853 (GRCm38) critical splice donor site probably null
R8967:Akap13 UTSW 7 75,729,134 (GRCm38) missense possibly damaging 0.80
R8986:Akap13 UTSW 7 75,609,326 (GRCm38) missense probably benign
R9152:Akap13 UTSW 7 75,611,285 (GRCm38) missense probably damaging 0.98
R9153:Akap13 UTSW 7 75,609,481 (GRCm38) missense probably benign 0.00
R9160:Akap13 UTSW 7 75,735,778 (GRCm38) missense possibly damaging 0.88
R9192:Akap13 UTSW 7 75,704,501 (GRCm38) missense probably benign 0.06
R9319:Akap13 UTSW 7 75,609,088 (GRCm38) missense probably benign 0.01
R9513:Akap13 UTSW 7 75,704,527 (GRCm38) missense probably benign 0.01
R9515:Akap13 UTSW 7 75,704,527 (GRCm38) missense probably benign 0.01
R9516:Akap13 UTSW 7 75,704,527 (GRCm38) missense probably benign 0.01
R9523:Akap13 UTSW 7 75,643,445 (GRCm38) missense
R9564:Akap13 UTSW 7 75,609,413 (GRCm38) missense probably benign
R9621:Akap13 UTSW 7 75,736,342 (GRCm38) missense probably benign 0.09
R9686:Akap13 UTSW 7 75,586,336 (GRCm38) missense probably damaging 1.00
Z1176:Akap13 UTSW 7 75,730,552 (GRCm38) missense probably damaging 0.99
Z1177:Akap13 UTSW 7 75,615,005 (GRCm38) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GTGCAGCTTTTGCCAAGGGATTAG -3'
(R):5'- TGAAGGTTCATGCCGAGACCACAG -3'

Sequencing Primer
(F):5'- CTGGATGGATGTCAACTGGAC -3'
(R):5'- CTAGGCCACAGTCCTGTAATTGG -3'
Posted On 2014-05-23