Mutagenetix > Incidental Mutations

Incidental Mutation 'R1773:Nup133'

196820

Institutional Source

Beutler Lab

Gene Symbol

Nup133

Ensembl Gene

ENSMUSG00000039509

Gene Name

nucleoporin 133

Synonyms

mermaid, 4832420O05Rik

MMRRC Submission

039804-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1773 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123897123-123949265 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 123930983 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 404 (C404*)

Ref Sequence

ENSEMBL: ENSMUSP00000048084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]

Predicted Effect

probably null
Transcript: ENSMUST00000044795
AA Change: C404*

SMART Domains

Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: C404*

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
PDB:1XKS\|A	66	513	N/A	PDB
Pfam:Nucleoporin_C	593	1052	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212133

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	A	G	7: 27,580,595	K334E	probably damaging	Het
Abca12	A	G	1: 71,288,596	Y1442H	probably damaging	Het
Acot12	A	G	13: 91,757,557	T79A	probably benign	Het
Adipoq	A	C	16: 23,155,238	Q26P	unknown	Het
Akap13	T	A	7: 75,683,451	N1582K	possibly damaging	Het
Alg9	A	G	9: 50,779,096	T133A	probably benign	Het
Anks3	T	C	16: 4,947,294	T418A	probably benign	Het
Ano3	A	C	2: 110,761,455	L37R	probably damaging	Het
Ano9	A	G	7: 141,108,378	F178L	possibly damaging	Het
Arhgef12	A	G	9: 43,005,542		probably null	Het
Arl16	T	A	11: 120,465,763	I137F	possibly damaging	Het
Brpf1	T	A	6: 113,319,931	S959T	possibly damaging	Het
C530008M17Rik	G	T	5: 76,867,205	A42S	possibly damaging	Het
Ccdc27	C	T	4: 154,041,765	R89Q	unknown	Het
Cd109	A	C	9: 78,703,724	Q1207H	probably benign	Het
Cd14	A	T	18: 36,725,304	V366D	possibly damaging	Het
Cep290	G	A	10: 100,510,573	V538I	probably benign	Het
Cep57	G	A	9: 13,816,068	A202V	probably damaging	Het
Chl1	T	C	6: 103,647,331		probably null	Het
Cmah	T	G	13: 24,417,299	F29L	probably benign	Het
Crybg1	A	G	10: 43,992,548	V1378A	possibly damaging	Het
Cryzl2	A	G	1: 157,470,722	K227R	probably benign	Het
D130043K22Rik	T	G	13: 24,882,602	V794G	possibly damaging	Het
Ddx4	T	A	13: 112,599,902	T645S	probably benign	Het
Dhcr7	C	T	7: 143,847,458	R453C	possibly damaging	Het
Dhx8	T	C	11: 101,752,363	Y754H	possibly damaging	Het
Dip2b	T	A	15: 100,193,961	D860E	probably benign	Het
Dnah7a	T	C	1: 53,432,887		probably null	Het
Dst	A	G	1: 34,291,899	D6937G	probably damaging	Het
Dusp1	A	G	17: 26,507,107	I204T	probably damaging	Het
Dync2h1	T	A	9: 7,128,256	Q1859L	probably damaging	Het
E4f1	C	A	17: 24,446,584	G328V	probably damaging	Het
Eml5	T	C	12: 98,798,839	Y1617C	probably damaging	Het
Espn	G	T	4: 152,128,229	P622Q	probably damaging	Het
Fam184b	G	A	5: 45,584,334	P185L	possibly damaging	Het
Fam71f1	T	C	6: 29,334,153	S335P	possibly damaging	Het
Fn1	T	A	1: 71,637,383	D563V	probably damaging	Het
Gad2	A	G	2: 22,690,207	Y540C	probably benign	Het
Gdf11	T	C	10: 128,891,294	D131G	probably damaging	Het
Gm19965	T	A	1: 116,821,259	Y223*	probably null	Het
H2-M10.6	A	G	17: 36,812,184	K3R	probably benign	Het
Hid1	A	G	11: 115,348,510	Y776H	probably damaging	Het
Hivep3	A	T	4: 120,098,837	K1450I	probably damaging	Het
Icam5	T	C	9: 21,033,525	L128P	possibly damaging	Het
Idnk	T	C	13: 58,157,712	V9A	probably damaging	Het
Il4ra	A	T	7: 125,567,182	T33S	possibly damaging	Het
Ino80	A	G	2: 119,418,409	V990A	probably benign	Het
Krtap4-9	T	C	11: 99,785,570		probably benign	Het
Lrrk2	A	G	15: 91,779,981	I1974V	possibly damaging	Het
Mcm3ap	C	T	10: 76,471,160	A369V	probably benign	Het
Nek6	A	G	2: 38,582,419	M252V	probably benign	Het
Nfasc	T	A	1: 132,610,839	I443F	probably damaging	Het
Nme8	T	G	13: 19,697,036	M1L	probably damaging	Het
Npnt	T	A	3: 132,904,693	Q423L	possibly damaging	Het
Olfr1232	A	G	2: 89,325,742	V146A	probably benign	Het
Olfr1307	A	G	2: 111,944,859	V199A	possibly damaging	Het
Olfr1535	T	C	13: 21,555,812	D70G	probably damaging	Het
Olfr262	T	C	19: 12,241,659	M1V	probably null	Het
Olfr684	T	C	7: 105,156,983	E233G	probably benign	Het
Olfr806	A	G	10: 129,738,443	L158S	probably damaging	Het
Otog	T	A	7: 46,288,159	I1764N	probably benign	Het
Oxa1l	A	G	14: 54,363,452	I127M	probably benign	Het
P4hb	C	A	11: 120,572,726	V28F	probably damaging	Het
Pbld2	C	T	10: 63,054,371	A186V	probably benign	Het
Pdzph1	G	T	17: 58,974,813	T158K	probably damaging	Het
Pgm1	T	A	5: 64,107,851		probably null	Het
Phip	A	T	9: 82,876,189	S1484T	probably benign	Het
Pikfyve	T	C	1: 65,192,271	L100P	probably damaging	Het
Pikfyve	T	C	1: 65,246,370	S923P	probably benign	Het
Pla2g4e	A	G	2: 120,244,721	S63P	probably benign	Het
Plekhh2	A	G	17: 84,599,265	E1176G	probably damaging	Het
Prlr	T	A	15: 10,325,318	Y192*	probably null	Het
Pten	T	A	19: 32,798,072	C71S	probably damaging	Het
Rbbp8nl	A	G	2: 180,281,194	L202P	probably benign	Het
Ripor2	T	A	13: 24,701,254	S491T	probably benign	Het
Robo1	A	T	16: 73,004,511	I1008F	probably benign	Het
Scg2	T	C	1: 79,435,635	N417S	probably benign	Het
Scn8a	A	G	15: 101,039,615	I1581V	probably damaging	Het
Slc22a8	T	A	19: 8,594,229	I108N	probably damaging	Het
Slc9a8	A	T	2: 167,471,465	T416S	possibly damaging	Het
Spata32	T	A	11: 103,208,818	E287V	probably damaging	Het
Spata5	T	C	3: 37,439,185	F515L	probably damaging	Het
Tgfbrap1	C	T	1: 43,075,352	G196D	probably damaging	Het
Tgm5	G	T	2: 121,077,650	T15K	possibly damaging	Het
Tmc1	C	T	19: 20,826,501		probably null	Het
Tmem177	T	C	1: 119,910,576	I124M	possibly damaging	Het
Trim30a	A	G	7: 104,435,901	F34S	probably damaging	Het
Tsn	T	C	1: 118,305,239	T112A	probably benign	Het
Tspyl5	T	G	15: 33,686,776	N341T	probably benign	Het
Vmn2r108	C	T	17: 20,469,073	C540Y	probably damaging	Het
Vrtn	C	T	12: 84,650,224	R583W	probably damaging	Het
Wnt1	T	C	15: 98,791,757	S142P	probably damaging	Het
Wrn	A	T	8: 33,343,561	I108N	probably damaging	Het
Zfhx2	A	C	14: 55,072,891	C733G	possibly damaging	Het
Zfp219	T	C	14: 52,007,106	T539A	probably damaging	Het
Zswim8	T	A	14: 20,711,530	M177K	probably damaging	Het

Other mutations in Nup133

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Nup133	APN	8	123939083	missense	probably damaging	0.98
IGL00507:Nup133	APN	8	123918967	nonsense	probably null
IGL00585:Nup133	APN	8	123909994	missense	probably damaging	1.00
IGL00676:Nup133	APN	8	123906298	intron	probably benign
IGL00966:Nup133	APN	8	123911906	missense	probably damaging	0.98
IGL01069:Nup133	APN	8	123930982	nonsense	probably null
IGL01553:Nup133	APN	8	123915324	missense	possibly damaging	0.58
IGL01669:Nup133	APN	8	123939130	nonsense	probably null
IGL01730:Nup133	APN	8	123938233	missense	probably benign	0.00
IGL01996:Nup133	APN	8	123946595	missense	probably benign	0.00
IGL02332:Nup133	APN	8	123907832	missense	probably damaging	1.00
IGL02552:Nup133	APN	8	123929255	missense	possibly damaging	0.75
IGL02956:Nup133	APN	8	123949083	missense	probably benign	0.00
IGL03009:Nup133	APN	8	123933500	missense	possibly damaging	0.46
IGL03036:Nup133	APN	8	123946594	missense	probably benign	0.11
Slant	UTSW	8	123916281	splice site	probably null
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0139:Nup133	UTSW	8	123929343	missense	probably benign	0.00
R0344:Nup133	UTSW	8	123917446	missense	possibly damaging	0.82
R0730:Nup133	UTSW	8	123949008	missense	probably benign	0.00
R1301:Nup133	UTSW	8	123917417	intron	probably benign
R1453:Nup133	UTSW	8	123915375	missense	probably benign	0.00
R1570:Nup133	UTSW	8	123949176	start codon destroyed	possibly damaging	0.82
R1607:Nup133	UTSW	8	123949035	missense	probably benign	0.02
R1992:Nup133	UTSW	8	123906221	missense	possibly damaging	0.80
R2062:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2065:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2066:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2068:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R4397:Nup133	UTSW	8	123944301	missense	probably benign	0.04
R4683:Nup133	UTSW	8	123930982	nonsense	probably null
R4771:Nup133	UTSW	8	123929398	missense	probably damaging	1.00
R4910:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4911:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4968:Nup133	UTSW	8	123915196	missense	probably benign	0.07
R5411:Nup133	UTSW	8	123927206	missense	probably benign
R5470:Nup133	UTSW	8	123930966	missense	probably benign	0.00
R5664:Nup133	UTSW	8	123906281	missense	probably benign	0.01
R5907:Nup133	UTSW	8	123916299	missense	possibly damaging	0.90
R6003:Nup133	UTSW	8	123938292	missense	probably damaging	0.98
R6059:Nup133	UTSW	8	123914596	missense	probably damaging	1.00
R6219:Nup133	UTSW	8	123936873	missense	possibly damaging	0.90
R6292:Nup133	UTSW	8	123917437	missense	probably benign	0.01
R6672:Nup133	UTSW	8	123916281	splice site	probably null
R6737:Nup133	UTSW	8	123906291	missense	probably damaging	0.99
R6763:Nup133	UTSW	8	123944278	missense	possibly damaging	0.95
R6870:Nup133	UTSW	8	123899507	missense	probably benign	0.08
R6975:Nup133	UTSW	8	123915318	missense	probably damaging	0.99
R7101:Nup133	UTSW	8	123906227	missense	possibly damaging	0.89
R7114:Nup133	UTSW	8	123915373	missense	probably benign	0.00
R7271:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R7501:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R8054:Nup133	UTSW	8	123949217
X0023:Nup133	UTSW	8	123909988	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CGGGAGTTCAGAATGTGACATGTGC -3'
(R):5'- CAGGCAGTCGCAGGGATTATAAACC -3'

Sequencing Primer
(F):5'- GCATAGGACTGACTGAATTCTGAC -3'
(R):5'- CCTGTCTATGAACCATCTGTGTAGTG -3'

Posted On

2014-05-23