Incidental Mutation 'R1773:Nup133'
ID 196820
Institutional Source Beutler Lab
Gene Symbol Nup133
Ensembl Gene ENSMUSG00000039509
Gene Name nucleoporin 133
Synonyms 4832420O05Rik, mermaid
MMRRC Submission 039804-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1773 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 124623862-124676004 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 124657722 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 404 (C404*)
Ref Sequence ENSEMBL: ENSMUSP00000048084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]
AlphaFold Q8R0G9
Predicted Effect probably null
Transcript: ENSMUST00000044795
AA Change: C404*
SMART Domains Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: C404*

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
PDB:1XKS|A 66 513 N/A PDB
Pfam:Nucleoporin_C 593 1052 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212133
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,280,020 (GRCm39) K334E probably damaging Het
Abca12 A G 1: 71,327,755 (GRCm39) Y1442H probably damaging Het
Acot12 A G 13: 91,905,676 (GRCm39) T79A probably benign Het
Adipoq A C 16: 22,973,988 (GRCm39) Q26P unknown Het
Afg2a T C 3: 37,493,334 (GRCm39) F515L probably damaging Het
Akap13 T A 7: 75,333,199 (GRCm39) N1582K possibly damaging Het
Alg9 A G 9: 50,690,396 (GRCm39) T133A probably benign Het
Anks3 T C 16: 4,765,158 (GRCm39) T418A probably benign Het
Ano3 A C 2: 110,591,800 (GRCm39) L37R probably damaging Het
Ano9 A G 7: 140,688,291 (GRCm39) F178L possibly damaging Het
Arhgef12 A G 9: 42,916,838 (GRCm39) probably null Het
Arl16 T A 11: 120,356,589 (GRCm39) I137F possibly damaging Het
Brpf1 T A 6: 113,296,892 (GRCm39) S959T possibly damaging Het
Ccdc27 C T 4: 154,126,222 (GRCm39) R89Q unknown Het
Cd109 A C 9: 78,611,006 (GRCm39) Q1207H probably benign Het
Cd14 A T 18: 36,858,357 (GRCm39) V366D possibly damaging Het
Cep290 G A 10: 100,346,435 (GRCm39) V538I probably benign Het
Cep57 G A 9: 13,727,364 (GRCm39) A202V probably damaging Het
Chl1 T C 6: 103,624,292 (GRCm39) probably null Het
Cmah T G 13: 24,601,282 (GRCm39) F29L probably benign Het
Cracd G T 5: 77,015,052 (GRCm39) A42S possibly damaging Het
Crybg1 A G 10: 43,868,544 (GRCm39) V1378A possibly damaging Het
Cryzl2 A G 1: 157,298,292 (GRCm39) K227R probably benign Het
D130043K22Rik T G 13: 25,066,585 (GRCm39) V794G possibly damaging Het
Ddx4 T A 13: 112,736,436 (GRCm39) T645S probably benign Het
Dhcr7 C T 7: 143,401,195 (GRCm39) R453C possibly damaging Het
Dhx8 T C 11: 101,643,189 (GRCm39) Y754H possibly damaging Het
Dip2b T A 15: 100,091,842 (GRCm39) D860E probably benign Het
Dnah7a T C 1: 53,472,046 (GRCm39) probably null Het
Dst A G 1: 34,330,980 (GRCm39) D6937G probably damaging Het
Dusp1 A G 17: 26,726,081 (GRCm39) I204T probably damaging Het
Dync2h1 T A 9: 7,128,256 (GRCm39) Q1859L probably damaging Het
E4f1 C A 17: 24,665,558 (GRCm39) G328V probably damaging Het
Eml5 T C 12: 98,765,098 (GRCm39) Y1617C probably damaging Het
Espn G T 4: 152,212,686 (GRCm39) P622Q probably damaging Het
Fam184b G A 5: 45,741,676 (GRCm39) P185L possibly damaging Het
Fn1 T A 1: 71,676,542 (GRCm39) D563V probably damaging Het
Gad2 A G 2: 22,580,219 (GRCm39) Y540C probably benign Het
Garin1b T C 6: 29,334,152 (GRCm39) S335P possibly damaging Het
Gdf11 T C 10: 128,727,163 (GRCm39) D131G probably damaging Het
Gm19965 T A 1: 116,748,989 (GRCm39) Y223* probably null Het
H2-M10.6 A G 17: 37,123,076 (GRCm39) K3R probably benign Het
Hid1 A G 11: 115,239,336 (GRCm39) Y776H probably damaging Het
Hivep3 A T 4: 119,956,034 (GRCm39) K1450I probably damaging Het
Icam5 T C 9: 20,944,821 (GRCm39) L128P possibly damaging Het
Idnk T C 13: 58,305,526 (GRCm39) V9A probably damaging Het
Il4ra A T 7: 125,166,354 (GRCm39) T33S possibly damaging Het
Ino80 A G 2: 119,248,890 (GRCm39) V990A probably benign Het
Krtap4-9 T C 11: 99,676,396 (GRCm39) probably benign Het
Lrrk2 A G 15: 91,664,184 (GRCm39) I1974V possibly damaging Het
Mcm3ap C T 10: 76,306,994 (GRCm39) A369V probably benign Het
Nek6 A G 2: 38,472,431 (GRCm39) M252V probably benign Het
Nfasc T A 1: 132,538,577 (GRCm39) I443F probably damaging Het
Nme8 T G 13: 19,881,206 (GRCm39) M1L probably damaging Het
Npnt T A 3: 132,610,454 (GRCm39) Q423L possibly damaging Het
Or2b7 T C 13: 21,739,982 (GRCm39) D70G probably damaging Het
Or4c124 A G 2: 89,156,086 (GRCm39) V146A probably benign Het
Or4f14b A G 2: 111,775,204 (GRCm39) V199A possibly damaging Het
Or56a4 T C 7: 104,806,190 (GRCm39) E233G probably benign Het
Or5an1c T C 19: 12,219,023 (GRCm39) M1V probably null Het
Or6c213 A G 10: 129,574,312 (GRCm39) L158S probably damaging Het
Otog T A 7: 45,937,583 (GRCm39) I1764N probably benign Het
Oxa1l A G 14: 54,600,909 (GRCm39) I127M probably benign Het
P4hb C A 11: 120,463,552 (GRCm39) V28F probably damaging Het
Pbld2 C T 10: 62,890,150 (GRCm39) A186V probably benign Het
Pdzph1 G T 17: 59,281,808 (GRCm39) T158K probably damaging Het
Pgm2 T A 5: 64,265,194 (GRCm39) probably null Het
Phip A T 9: 82,758,242 (GRCm39) S1484T probably benign Het
Pikfyve T C 1: 65,231,430 (GRCm39) L100P probably damaging Het
Pikfyve T C 1: 65,285,529 (GRCm39) S923P probably benign Het
Pla2g4e A G 2: 120,075,202 (GRCm39) S63P probably benign Het
Plekhh2 A G 17: 84,906,693 (GRCm39) E1176G probably damaging Het
Prlr T A 15: 10,325,404 (GRCm39) Y192* probably null Het
Pten T A 19: 32,775,472 (GRCm39) C71S probably damaging Het
Rbbp8nl A G 2: 179,922,987 (GRCm39) L202P probably benign Het
Ripor2 T A 13: 24,885,237 (GRCm39) S491T probably benign Het
Robo1 A T 16: 72,801,399 (GRCm39) I1008F probably benign Het
Scg2 T C 1: 79,413,352 (GRCm39) N417S probably benign Het
Scn8a A G 15: 100,937,496 (GRCm39) I1581V probably damaging Het
Slc22a8 T A 19: 8,571,593 (GRCm39) I108N probably damaging Het
Slc9a8 A T 2: 167,313,385 (GRCm39) T416S possibly damaging Het
Spata32 T A 11: 103,099,644 (GRCm39) E287V probably damaging Het
Tgfbrap1 C T 1: 43,114,512 (GRCm39) G196D probably damaging Het
Tgm5 G T 2: 120,908,131 (GRCm39) T15K possibly damaging Het
Tmc1 C T 19: 20,803,865 (GRCm39) probably null Het
Tmem177 T C 1: 119,838,306 (GRCm39) I124M possibly damaging Het
Trim30a A G 7: 104,085,108 (GRCm39) F34S probably damaging Het
Tsn T C 1: 118,232,969 (GRCm39) T112A probably benign Het
Tspyl5 T G 15: 33,686,922 (GRCm39) N341T probably benign Het
Vmn2r108 C T 17: 20,689,335 (GRCm39) C540Y probably damaging Het
Vrtn C T 12: 84,696,998 (GRCm39) R583W probably damaging Het
Wnt1 T C 15: 98,689,638 (GRCm39) S142P probably damaging Het
Wrn A T 8: 33,833,589 (GRCm39) I108N probably damaging Het
Zfhx2 A C 14: 55,310,348 (GRCm39) C733G possibly damaging Het
Zfp219 T C 14: 52,244,563 (GRCm39) T539A probably damaging Het
Zswim8 T A 14: 20,761,598 (GRCm39) M177K probably damaging Het
Other mutations in Nup133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Nup133 APN 8 124,665,822 (GRCm39) missense probably damaging 0.98
IGL00507:Nup133 APN 8 124,645,706 (GRCm39) nonsense probably null
IGL00585:Nup133 APN 8 124,636,733 (GRCm39) missense probably damaging 1.00
IGL00676:Nup133 APN 8 124,633,037 (GRCm39) intron probably benign
IGL00966:Nup133 APN 8 124,638,645 (GRCm39) missense probably damaging 0.98
IGL01069:Nup133 APN 8 124,657,721 (GRCm39) nonsense probably null
IGL01553:Nup133 APN 8 124,642,063 (GRCm39) missense possibly damaging 0.58
IGL01669:Nup133 APN 8 124,665,869 (GRCm39) nonsense probably null
IGL01730:Nup133 APN 8 124,664,972 (GRCm39) missense probably benign 0.00
IGL01996:Nup133 APN 8 124,673,334 (GRCm39) missense probably benign 0.00
IGL02332:Nup133 APN 8 124,634,571 (GRCm39) missense probably damaging 1.00
IGL02552:Nup133 APN 8 124,655,994 (GRCm39) missense possibly damaging 0.75
IGL02956:Nup133 APN 8 124,675,822 (GRCm39) missense probably benign 0.00
IGL03009:Nup133 APN 8 124,660,239 (GRCm39) missense possibly damaging 0.46
IGL03036:Nup133 APN 8 124,673,333 (GRCm39) missense probably benign 0.11
Cadenza UTSW 8 124,638,627 (GRCm39) frame shift probably null
Gangen UTSW 8 124,643,021 (GRCm39) critical splice donor site probably null
hochzeit UTSW 8 124,656,082 (GRCm39) missense probably benign 0.00
low_road UTSW 8 124,631,318 (GRCm39) missense probably damaging 1.00
Pathway UTSW 8 124,644,185 (GRCm39) missense possibly damaging 0.82
Slant UTSW 8 124,643,020 (GRCm39) splice site probably null
R0010:Nup133 UTSW 8 124,631,318 (GRCm39) missense probably damaging 1.00
R0010:Nup133 UTSW 8 124,631,318 (GRCm39) missense probably damaging 1.00
R0139:Nup133 UTSW 8 124,656,082 (GRCm39) missense probably benign 0.00
R0344:Nup133 UTSW 8 124,644,185 (GRCm39) missense possibly damaging 0.82
R0730:Nup133 UTSW 8 124,675,747 (GRCm39) missense probably benign 0.00
R1301:Nup133 UTSW 8 124,644,156 (GRCm39) intron probably benign
R1453:Nup133 UTSW 8 124,642,114 (GRCm39) missense probably benign 0.00
R1570:Nup133 UTSW 8 124,675,915 (GRCm39) start codon destroyed possibly damaging 0.82
R1607:Nup133 UTSW 8 124,675,774 (GRCm39) missense probably benign 0.02
R1992:Nup133 UTSW 8 124,632,960 (GRCm39) missense possibly damaging 0.80
R2062:Nup133 UTSW 8 124,641,314 (GRCm39) missense probably damaging 1.00
R2065:Nup133 UTSW 8 124,641,314 (GRCm39) missense probably damaging 1.00
R2066:Nup133 UTSW 8 124,641,314 (GRCm39) missense probably damaging 1.00
R2068:Nup133 UTSW 8 124,641,314 (GRCm39) missense probably damaging 1.00
R4397:Nup133 UTSW 8 124,671,040 (GRCm39) missense probably benign 0.04
R4683:Nup133 UTSW 8 124,657,721 (GRCm39) nonsense probably null
R4771:Nup133 UTSW 8 124,656,137 (GRCm39) missense probably damaging 1.00
R4910:Nup133 UTSW 8 124,653,870 (GRCm39) missense possibly damaging 0.91
R4911:Nup133 UTSW 8 124,653,870 (GRCm39) missense possibly damaging 0.91
R4968:Nup133 UTSW 8 124,641,935 (GRCm39) missense probably benign 0.07
R5411:Nup133 UTSW 8 124,653,945 (GRCm39) missense probably benign
R5470:Nup133 UTSW 8 124,657,705 (GRCm39) missense probably benign 0.00
R5664:Nup133 UTSW 8 124,633,020 (GRCm39) missense probably benign 0.01
R5907:Nup133 UTSW 8 124,643,038 (GRCm39) missense possibly damaging 0.90
R6003:Nup133 UTSW 8 124,665,031 (GRCm39) missense probably damaging 0.98
R6059:Nup133 UTSW 8 124,641,335 (GRCm39) missense probably damaging 1.00
R6219:Nup133 UTSW 8 124,663,612 (GRCm39) missense possibly damaging 0.90
R6292:Nup133 UTSW 8 124,644,176 (GRCm39) missense probably benign 0.01
R6672:Nup133 UTSW 8 124,643,020 (GRCm39) splice site probably null
R6737:Nup133 UTSW 8 124,633,030 (GRCm39) missense probably damaging 0.99
R6763:Nup133 UTSW 8 124,671,017 (GRCm39) missense possibly damaging 0.95
R6870:Nup133 UTSW 8 124,626,246 (GRCm39) missense probably benign 0.08
R6975:Nup133 UTSW 8 124,642,057 (GRCm39) missense probably damaging 0.99
R7101:Nup133 UTSW 8 124,632,966 (GRCm39) missense possibly damaging 0.89
R7114:Nup133 UTSW 8 124,642,112 (GRCm39) missense probably benign 0.00
R7271:Nup133 UTSW 8 124,649,153 (GRCm39) missense probably benign 0.34
R7501:Nup133 UTSW 8 124,649,153 (GRCm39) missense probably benign 0.34
R8054:Nup133 UTSW 8 124,675,956 (GRCm39) intron probably benign
R8397:Nup133 UTSW 8 124,649,156 (GRCm39) missense probably benign 0.17
R8703:Nup133 UTSW 8 124,643,021 (GRCm39) critical splice donor site probably null
R8811:Nup133 UTSW 8 124,638,627 (GRCm39) frame shift probably null
R8813:Nup133 UTSW 8 124,638,627 (GRCm39) frame shift probably null
R8952:Nup133 UTSW 8 124,634,500 (GRCm39) missense probably damaging 1.00
R9116:Nup133 UTSW 8 124,660,155 (GRCm39) missense probably benign 0.00
R9340:Nup133 UTSW 8 124,664,881 (GRCm39) missense probably benign 0.38
X0023:Nup133 UTSW 8 124,636,727 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGGAGTTCAGAATGTGACATGTGC -3'
(R):5'- CAGGCAGTCGCAGGGATTATAAACC -3'

Sequencing Primer
(F):5'- GCATAGGACTGACTGAATTCTGAC -3'
(R):5'- CCTGTCTATGAACCATCTGTGTAGTG -3'
Posted On 2014-05-23