Mutagenetix > Incidental Mutation

Incidental Mutation 'R1773:Eml5'

196841

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

039804-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.237) question?

Stock #

R1773 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98798839 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1617 (Y1617C)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

probably damaging
Transcript: ENSMUST00000065716
AA Change: Y1570C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: Y1570C

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220676

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221107

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221511

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221902

Predicted Effect

unknown
Transcript: ENSMUST00000222097
AA Change: T118A

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222593

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222717

Predicted Effect

probably damaging
Transcript: ENSMUST00000223282
AA Change: Y1617C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	A	G	7: 27,580,595	K334E	probably damaging	Het
Abca12	A	G	1: 71,288,596	Y1442H	probably damaging	Het
Acot12	A	G	13: 91,757,557	T79A	probably benign	Het
Adipoq	A	C	16: 23,155,238	Q26P	unknown	Het
Akap13	T	A	7: 75,683,451	N1582K	possibly damaging	Het
Alg9	A	G	9: 50,779,096	T133A	probably benign	Het
Anks3	T	C	16: 4,947,294	T418A	probably benign	Het
Ano3	A	C	2: 110,761,455	L37R	probably damaging	Het
Ano9	A	G	7: 141,108,378	F178L	possibly damaging	Het
Arhgef12	A	G	9: 43,005,542		probably null	Het
Arl16	T	A	11: 120,465,763	I137F	possibly damaging	Het
Brpf1	T	A	6: 113,319,931	S959T	possibly damaging	Het
C530008M17Rik	G	T	5: 76,867,205	A42S	possibly damaging	Het
Ccdc27	C	T	4: 154,041,765	R89Q	unknown	Het
Cd109	A	C	9: 78,703,724	Q1207H	probably benign	Het
Cd14	A	T	18: 36,725,304	V366D	possibly damaging	Het
Cep290	G	A	10: 100,510,573	V538I	probably benign	Het
Cep57	G	A	9: 13,816,068	A202V	probably damaging	Het
Chl1	T	C	6: 103,647,331		probably null	Het
Cmah	T	G	13: 24,417,299	F29L	probably benign	Het
Crybg1	A	G	10: 43,992,548	V1378A	possibly damaging	Het
Cryzl2	A	G	1: 157,470,722	K227R	probably benign	Het
D130043K22Rik	T	G	13: 24,882,602	V794G	possibly damaging	Het
Ddx4	T	A	13: 112,599,902	T645S	probably benign	Het
Dhcr7	C	T	7: 143,847,458	R453C	possibly damaging	Het
Dhx8	T	C	11: 101,752,363	Y754H	possibly damaging	Het
Dip2b	T	A	15: 100,193,961	D860E	probably benign	Het
Dnah7a	T	C	1: 53,432,887		probably null	Het
Dst	A	G	1: 34,291,899	D6937G	probably damaging	Het
Dusp1	A	G	17: 26,507,107	I204T	probably damaging	Het
Dync2h1	T	A	9: 7,128,256	Q1859L	probably damaging	Het
E4f1	C	A	17: 24,446,584	G328V	probably damaging	Het
Espn	G	T	4: 152,128,229	P622Q	probably damaging	Het
Fam184b	G	A	5: 45,584,334	P185L	possibly damaging	Het
Fam71f1	T	C	6: 29,334,153	S335P	possibly damaging	Het
Fn1	T	A	1: 71,637,383	D563V	probably damaging	Het
Gad2	A	G	2: 22,690,207	Y540C	probably benign	Het
Gdf11	T	C	10: 128,891,294	D131G	probably damaging	Het
Gm19965	T	A	1: 116,821,259	Y223*	probably null	Het
H2-M10.6	A	G	17: 36,812,184	K3R	probably benign	Het
Hid1	A	G	11: 115,348,510	Y776H	probably damaging	Het
Hivep3	A	T	4: 120,098,837	K1450I	probably damaging	Het
Icam5	T	C	9: 21,033,525	L128P	possibly damaging	Het
Idnk	T	C	13: 58,157,712	V9A	probably damaging	Het
Il4ra	A	T	7: 125,567,182	T33S	possibly damaging	Het
Ino80	A	G	2: 119,418,409	V990A	probably benign	Het
Krtap4-9	T	C	11: 99,785,570		probably benign	Het
Lrrk2	A	G	15: 91,779,981	I1974V	possibly damaging	Het
Mcm3ap	C	T	10: 76,471,160	A369V	probably benign	Het
Nek6	A	G	2: 38,582,419	M252V	probably benign	Het
Nfasc	T	A	1: 132,610,839	I443F	probably damaging	Het
Nme8	T	G	13: 19,697,036	M1L	probably damaging	Het
Npnt	T	A	3: 132,904,693	Q423L	possibly damaging	Het
Nup133	A	T	8: 123,930,983	C404*	probably null	Het
Olfr1232	A	G	2: 89,325,742	V146A	probably benign	Het
Olfr1307	A	G	2: 111,944,859	V199A	possibly damaging	Het
Olfr1535	T	C	13: 21,555,812	D70G	probably damaging	Het
Olfr262	T	C	19: 12,241,659	M1V	probably null	Het
Olfr684	T	C	7: 105,156,983	E233G	probably benign	Het
Olfr806	A	G	10: 129,738,443	L158S	probably damaging	Het
Otog	T	A	7: 46,288,159	I1764N	probably benign	Het
Oxa1l	A	G	14: 54,363,452	I127M	probably benign	Het
P4hb	C	A	11: 120,572,726	V28F	probably damaging	Het
Pbld2	C	T	10: 63,054,371	A186V	probably benign	Het
Pdzph1	G	T	17: 58,974,813	T158K	probably damaging	Het
Pgm1	T	A	5: 64,107,851		probably null	Het
Phip	A	T	9: 82,876,189	S1484T	probably benign	Het
Pikfyve	T	C	1: 65,192,271	L100P	probably damaging	Het
Pikfyve	T	C	1: 65,246,370	S923P	probably benign	Het
Pla2g4e	A	G	2: 120,244,721	S63P	probably benign	Het
Plekhh2	A	G	17: 84,599,265	E1176G	probably damaging	Het
Prlr	T	A	15: 10,325,318	Y192*	probably null	Het
Pten	T	A	19: 32,798,072	C71S	probably damaging	Het
Rbbp8nl	A	G	2: 180,281,194	L202P	probably benign	Het
Ripor2	T	A	13: 24,701,254	S491T	probably benign	Het
Robo1	A	T	16: 73,004,511	I1008F	probably benign	Het
Scg2	T	C	1: 79,435,635	N417S	probably benign	Het
Scn8a	A	G	15: 101,039,615	I1581V	probably damaging	Het
Slc22a8	T	A	19: 8,594,229	I108N	probably damaging	Het
Slc9a8	A	T	2: 167,471,465	T416S	possibly damaging	Het
Spata32	T	A	11: 103,208,818	E287V	probably damaging	Het
Spata5	T	C	3: 37,439,185	F515L	probably damaging	Het
Tgfbrap1	C	T	1: 43,075,352	G196D	probably damaging	Het
Tgm5	G	T	2: 121,077,650	T15K	possibly damaging	Het
Tmc1	C	T	19: 20,826,501		probably null	Het
Tmem177	T	C	1: 119,910,576	I124M	possibly damaging	Het
Trim30a	A	G	7: 104,435,901	F34S	probably damaging	Het
Tsn	T	C	1: 118,305,239	T112A	probably benign	Het
Tspyl5	T	G	15: 33,686,776	N341T	probably benign	Het
Vmn2r108	C	T	17: 20,469,073	C540Y	probably damaging	Het
Vrtn	C	T	12: 84,650,224	R583W	probably damaging	Het
Wnt1	T	C	15: 98,791,757	S142P	probably damaging	Het
Wrn	A	T	8: 33,343,561	I108N	probably damaging	Het
Zfhx2	A	C	14: 55,072,891	C733G	possibly damaging	Het
Zfp219	T	C	14: 52,007,106	T539A	probably damaging	Het
Zswim8	T	A	14: 20,711,530	M177K	probably damaging	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9393:Eml5	UTSW	12	98876174	missense	probably benign	0.35
R9449:Eml5	UTSW	12	98861295	missense	probably damaging	1.00
R9570:Eml5	UTSW	12	98815984	missense	probably benign	0.15
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TTAGCCTGCACAGCCTAGAAGGAAG -3'
(R):5'- AGTTACTGGACAGCCAAAGGCAC -3'

Sequencing Primer
(F):5'- GCCTAGAAGGAAGAGCCTCC -3'
(R):5'- CTTTGTCAAAGCAGGTGACC -3'

Posted On

2014-05-23