Incidental Mutation 'R0081:Il10ra'
ID19685
Institutional Source Beutler Lab
Gene Symbol Il10ra
Ensembl Gene ENSMUSG00000032089
Gene Nameinterleukin 10 receptor, alpha
SynonymsCDw210, Il10r, mIL-10R
MMRRC Submission 038368-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0081 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location45253837-45269149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45255949 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 435 (M435L)
Ref Sequence ENSEMBL: ENSMUSP00000135461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034594] [ENSMUST00000176222] [ENSMUST00000176808]
Predicted Effect probably benign
Transcript: ENSMUST00000034594
AA Change: M437L

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000034594
Gene: ENSMUSG00000032089
AA Change: M437L

DomainStartEndE-ValueType
Pfam:Tissue_fac 5 114 3.3e-29 PFAM
SCOP:d1lqsr2 125 231 5e-59 SMART
transmembrane domain 239 261 N/A INTRINSIC
low complexity region 482 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176222
AA Change: M435L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135461
Gene: ENSMUSG00000032089
AA Change: M435L

DomainStartEndE-ValueType
Pfam:Tissue_fac 2 112 3.5e-26 PFAM
SCOP:d1lqsr2 123 229 5e-59 SMART
transmembrane domain 237 259 N/A INTRINSIC
low complexity region 480 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176808
SMART Domains Protein: ENSMUSP00000135361
Gene: ENSMUSG00000032089

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.2%
  • 10x: 88.5%
  • 20x: 63.6%
Validation Efficiency 94% (159/169)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for interleukin 10. This protein is structurally related to interferon receptors. It has been shown to mediate the immunosuppressive signal of interleukin 10, and thus inhibits the synthesis of proinflammatory cytokines. This receptor is reported to promote survival of progenitor myeloid cells through the insulin receptor substrate-2/PI 3-kinase/AKT pathway. Activation of this receptor leads to tyrosine phosphorylation of JAK1 and TYK2 kinases. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for an ENU-generated null allele suffer from a severe inflammatory bowel syndrome. Mice heterozygote for an NZW variant allele have high sera levels of anti-chromatin antibodies. Mice homozygous for a knock-out allele exhibit increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T C 8: 24,781,687 D485G probably damaging Het
Adamts19 T C 18: 58,903,065 probably null Het
Adgrd1 A T 5: 129,178,082 I598F probably damaging Het
Adh5 A G 3: 138,451,413 D245G probably benign Het
Adra2b T C 2: 127,364,292 V238A probably benign Het
Ank1 G A 8: 23,116,242 V1188I possibly damaging Het
Asap1 C T 15: 64,099,564 G905D probably damaging Het
AW554918 T C 18: 25,344,902 V428A probably benign Het
Birc6 T A 17: 74,643,441 S3226T probably benign Het
Cdh17 A T 4: 11,785,280 probably benign Het
Cyfip2 A T 11: 46,253,998 Y676* probably null Het
Dcaf17 T A 2: 71,078,468 probably benign Het
Dclre1a A G 19: 56,542,707 F736L probably damaging Het
Ddx41 A T 13: 55,535,380 H171Q possibly damaging Het
Dennd5b G T 6: 148,993,759 Q1258K probably benign Het
Dock10 T C 1: 80,606,578 D137G probably damaging Het
Dpyd G A 3: 118,944,255 V482I probably benign Het
Erich6 A T 3: 58,636,126 probably benign Het
Fam193b A G 13: 55,554,211 probably benign Het
Foxp2 T C 6: 15,405,644 probably benign Het
Frmd4a T C 2: 4,572,441 probably null Het
Gas2l2 A G 11: 83,422,867 S540P possibly damaging Het
Glis2 T C 16: 4,613,653 V348A probably benign Het
Gm14443 C A 2: 175,169,936 G239V probably damaging Het
Gpr158 T C 2: 21,826,717 V876A probably damaging Het
H1foo A G 6: 115,949,981 E273G probably benign Het
Hadh C T 3: 131,235,636 D245N probably damaging Het
Hk2 A T 6: 82,734,976 probably benign Het
Ice1 A T 13: 70,619,044 Y108* probably null Het
Inpp5k GT G 11: 75,631,147 probably null Het
Kank4 G T 4: 98,778,330 P627T probably benign Het
Kif16b A G 2: 142,707,426 probably benign Het
Lipn A G 19: 34,076,976 I205V probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myh1 T C 11: 67,215,857 M1255T probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo1d T G 11: 80,557,523 K925N probably benign Het
Myoz1 T A 14: 20,649,554 M239L probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nf1 C A 11: 79,453,979 probably benign Het
Npepl1 C T 2: 174,116,086 P239S probably damaging Het
Olfml1 A G 7: 107,571,299 K131R probably benign Het
Olfr1258 T A 2: 89,930,079 I90K possibly damaging Het
Olfr1303 A C 2: 111,813,868 I286S probably damaging Het
Olfr344 T A 2: 36,568,881 Y94* probably null Het
Olfr352 T C 2: 36,870,010 L148S possibly damaging Het
Olfr358 G A 2: 37,005,450 L55F probably damaging Het
Olfr389 A G 11: 73,777,109 F73L possibly damaging Het
Olfr472 C T 7: 107,903,005 T96I probably benign Het
Olfr771 C T 10: 129,160,838 D49N possibly damaging Het
Pde7a T C 3: 19,241,533 probably benign Het
Pik3c2g T C 6: 139,957,793 C591R probably benign Het
Pkn2 T G 3: 142,853,582 K61Q probably damaging Het
Ppfia1 C A 7: 144,504,974 G722C probably damaging Het
Ppp1cb T C 5: 32,487,614 V263A probably damaging Het
Rab11fip2 A T 19: 59,907,135 N440K possibly damaging Het
Rbm34 T A 8: 126,949,484 K340N probably damaging Het
Samd3 T C 10: 26,271,501 probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sigirr T C 7: 141,091,372 D399G probably damaging Het
Slc17a7 A G 7: 45,174,947 E554G probably benign Het
Smc3 A G 19: 53,601,562 probably benign Het
Tdrd1 T C 19: 56,831,271 Y68H probably benign Het
Tespa1 T A 10: 130,360,850 L219Q probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Ttc38 A G 15: 85,856,472 S436G probably benign Het
Ttn T A 2: 76,751,079 I23157F probably damaging Het
Ubxn2b T A 4: 6,203,875 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r72 T C 7: 85,751,836 E125G probably benign Het
Vmn2r78 A T 7: 86,923,027 D532V probably benign Het
Vwa8 C A 14: 79,082,782 L1078I probably benign Het
Vwce A T 19: 10,664,089 probably null Het
Zpr1 A G 9: 46,279,697 D300G probably damaging Het
Other mutations in Il10ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Il10ra APN 9 45267160 missense probably damaging 1.00
IGL01916:Il10ra APN 9 45256146 missense probably damaging 1.00
IGL03067:Il10ra APN 9 45255859 missense probably benign 0.01
R0266:Il10ra UTSW 9 45265652 missense probably benign 0.11
R1734:Il10ra UTSW 9 45255943 missense probably benign 0.02
R1901:Il10ra UTSW 9 45256356 missense probably benign 0.39
R1991:Il10ra UTSW 9 45255811 missense probably benign 0.28
R2103:Il10ra UTSW 9 45255811 missense probably benign 0.28
R2218:Il10ra UTSW 9 45265616 missense probably benign
R4686:Il10ra UTSW 9 45269059 missense probably damaging 1.00
R4908:Il10ra UTSW 9 45255621 missense probably benign 0.21
R4982:Il10ra UTSW 9 45269059 missense probably damaging 1.00
R5590:Il10ra UTSW 9 45265626 nonsense probably null
R5739:Il10ra UTSW 9 45256070 missense possibly damaging 0.65
R5872:Il10ra UTSW 9 45255653 missense possibly damaging 0.92
R6053:Il10ra UTSW 9 45256303 missense probably damaging 0.99
R6282:Il10ra UTSW 9 45260405 missense probably damaging 0.98
R6798:Il10ra UTSW 9 45256432 missense probably damaging 0.99
R7060:Il10ra UTSW 9 45256224 missense probably benign 0.00
R7561:Il10ra UTSW 9 45255819 missense probably benign 0.00
R7630:Il10ra UTSW 9 45256071 missense probably damaging 1.00
R7709:Il10ra UTSW 9 45260399 missense probably benign 0.01
Z1176:Il10ra UTSW 9 45266632 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TCAAATAACCTGCGGCCAGAGC -3'
(R):5'- ACTGAAGAGTCCCAATTCCTCCTCC -3'

Sequencing Primer
(F):5'- AGCTGGTGGAGGCCAAG -3'
(R):5'- AGAGTCTCCAGGGCTACAG -3'
Posted On2013-04-11