Incidental Mutation 'R0081:Zpr1'
ID19686
Institutional Source Beutler Lab
Gene Symbol Zpr1
Ensembl Gene ENSMUSG00000032078
Gene NameZPR1 zinc finger
SynonymsZfp259, ZPR1
MMRRC Submission 038368-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0081 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location46273064-46282643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46279697 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 300 (D300G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074957] [ENSMUST00000156440]
Predicted Effect probably benign
Transcript: ENSMUST00000074957
SMART Domains Protein: ENSMUSP00000074490
Gene: ENSMUSG00000032077

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
internal_repeat_1 122 182 5.18e-30 PROSPERO
internal_repeat_1 174 234 5.18e-30 PROSPERO
low complexity region 394 417 N/A INTRINSIC
low complexity region 420 434 N/A INTRINSIC
Pfam:Bud13 478 620 2.8e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114552
AA Change: D300G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110199
Gene: ENSMUSG00000032078
AA Change: D300G

DomainStartEndE-ValueType
Zpr1 12 150 5.57e-30 SMART
Zpr1 184 343 4.27e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125239
SMART Domains Protein: ENSMUSP00000123437
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Blast:Zpr1 33 59 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143511
Predicted Effect probably damaging
Transcript: ENSMUST00000156440
AA Change: D374G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117725
Gene: ENSMUSG00000032078
AA Change: D374G

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Zpr1 49 207 1.47e-93 SMART
low complexity region 236 246 N/A INTRINSIC
Zpr1 257 416 4.27e-90 SMART
Meta Mutation Damage Score 0.9345 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.2%
  • 10x: 88.5%
  • 20x: 63.6%
Validation Efficiency 94% (159/169)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the cytoplasm of quiescent cells but translocates to the nucleolus in proliferating cells. The encoded protein interacts with survival motor neuron protein (SMN1) to enhance pre-mRNA splicing and to induce neuronal differentiation and axonal growth. Defects in this gene or the SMN1 gene can cause spinal muscular atrophy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice display embryonic lethality, fail to form a normal trophectoderm and fail to expand the inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T C 8: 24,781,687 D485G probably damaging Het
Adamts19 T C 18: 58,903,065 probably null Het
Adgrd1 A T 5: 129,178,082 I598F probably damaging Het
Adh5 A G 3: 138,451,413 D245G probably benign Het
Adra2b T C 2: 127,364,292 V238A probably benign Het
Ank1 G A 8: 23,116,242 V1188I possibly damaging Het
Asap1 C T 15: 64,099,564 G905D probably damaging Het
AW554918 T C 18: 25,344,902 V428A probably benign Het
Birc6 T A 17: 74,643,441 S3226T probably benign Het
Cdh17 A T 4: 11,785,280 probably benign Het
Cyfip2 A T 11: 46,253,998 Y676* probably null Het
Dcaf17 T A 2: 71,078,468 probably benign Het
Dclre1a A G 19: 56,542,707 F736L probably damaging Het
Ddx41 A T 13: 55,535,380 H171Q possibly damaging Het
Dennd5b G T 6: 148,993,759 Q1258K probably benign Het
Dock10 T C 1: 80,606,578 D137G probably damaging Het
Dpyd G A 3: 118,944,255 V482I probably benign Het
Erich6 A T 3: 58,636,126 probably benign Het
Fam193b A G 13: 55,554,211 probably benign Het
Foxp2 T C 6: 15,405,644 probably benign Het
Frmd4a T C 2: 4,572,441 probably null Het
Gas2l2 A G 11: 83,422,867 S540P possibly damaging Het
Glis2 T C 16: 4,613,653 V348A probably benign Het
Gm14443 C A 2: 175,169,936 G239V probably damaging Het
Gpr158 T C 2: 21,826,717 V876A probably damaging Het
H1foo A G 6: 115,949,981 E273G probably benign Het
Hadh C T 3: 131,235,636 D245N probably damaging Het
Hk2 A T 6: 82,734,976 probably benign Het
Ice1 A T 13: 70,619,044 Y108* probably null Het
Il10ra T G 9: 45,255,949 M435L probably benign Het
Inpp5k GT G 11: 75,631,147 probably null Het
Kank4 G T 4: 98,778,330 P627T probably benign Het
Kif16b A G 2: 142,707,426 probably benign Het
Lipn A G 19: 34,076,976 I205V probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myh1 T C 11: 67,215,857 M1255T probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo1d T G 11: 80,557,523 K925N probably benign Het
Myoz1 T A 14: 20,649,554 M239L probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nf1 C A 11: 79,453,979 probably benign Het
Npepl1 C T 2: 174,116,086 P239S probably damaging Het
Olfml1 A G 7: 107,571,299 K131R probably benign Het
Olfr1258 T A 2: 89,930,079 I90K possibly damaging Het
Olfr1303 A C 2: 111,813,868 I286S probably damaging Het
Olfr344 T A 2: 36,568,881 Y94* probably null Het
Olfr352 T C 2: 36,870,010 L148S possibly damaging Het
Olfr358 G A 2: 37,005,450 L55F probably damaging Het
Olfr389 A G 11: 73,777,109 F73L possibly damaging Het
Olfr472 C T 7: 107,903,005 T96I probably benign Het
Olfr771 C T 10: 129,160,838 D49N possibly damaging Het
Pde7a T C 3: 19,241,533 probably benign Het
Pik3c2g T C 6: 139,957,793 C591R probably benign Het
Pkn2 T G 3: 142,853,582 K61Q probably damaging Het
Ppfia1 C A 7: 144,504,974 G722C probably damaging Het
Ppp1cb T C 5: 32,487,614 V263A probably damaging Het
Rab11fip2 A T 19: 59,907,135 N440K possibly damaging Het
Rbm34 T A 8: 126,949,484 K340N probably damaging Het
Samd3 T C 10: 26,271,501 probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sigirr T C 7: 141,091,372 D399G probably damaging Het
Slc17a7 A G 7: 45,174,947 E554G probably benign Het
Smc3 A G 19: 53,601,562 probably benign Het
Tdrd1 T C 19: 56,831,271 Y68H probably benign Het
Tespa1 T A 10: 130,360,850 L219Q probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Ttc38 A G 15: 85,856,472 S436G probably benign Het
Ttn T A 2: 76,751,079 I23157F probably damaging Het
Ubxn2b T A 4: 6,203,875 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r72 T C 7: 85,751,836 E125G probably benign Het
Vmn2r78 A T 7: 86,923,027 D532V probably benign Het
Vwa8 C A 14: 79,082,782 L1078I probably benign Het
Vwce A T 19: 10,664,089 probably null Het
Other mutations in Zpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02960:Zpr1 APN 9 46273551 missense probably damaging 0.97
R0077:Zpr1 UTSW 9 46273336 missense probably damaging 1.00
R0674:Zpr1 UTSW 9 46275449 missense probably damaging 1.00
R2419:Zpr1 UTSW 9 46276192 splice site probably benign
R4956:Zpr1 UTSW 9 46274663 missense probably damaging 1.00
R4979:Zpr1 UTSW 9 46278342 missense probably benign 0.20
R5566:Zpr1 UTSW 9 46281075 missense possibly damaging 0.88
R6480:Zpr1 UTSW 9 46274711 missense probably benign 0.01
R6948:Zpr1 UTSW 9 46273641 critical splice donor site probably null
R7139:Zpr1 UTSW 9 46281059 missense probably damaging 1.00
R7366:Zpr1 UTSW 9 46273373 splice site probably null
R7996:Zpr1 UTSW 9 46273565 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGTTTCCTTCTTGGCAAAGCAGTC -3'
(R):5'- ACTTGGGAGTCCCACTATCACCAC -3'

Sequencing Primer
(F):5'- CTTGGCAAAGCAGTCTCATAG -3'
(R):5'- CCCTCGATGATCTACAGGAGAG -3'
Posted On2013-04-11