Incidental Mutation 'R1773:Dip2b'
ID 196860
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 039804-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.636) question?
Stock # R1773 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 100091842 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 860 (D860E)
Ref Sequence ENSEMBL: ENSMUSP00000023768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
AlphaFold Q3UH60
Predicted Effect probably benign
Transcript: ENSMUST00000023768
AA Change: D860E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: D860E

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100203
AA Change: D1094E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: D1094E

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108971
AA Change: D860E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: D860E

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230619
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,280,020 (GRCm39) K334E probably damaging Het
Abca12 A G 1: 71,327,755 (GRCm39) Y1442H probably damaging Het
Acot12 A G 13: 91,905,676 (GRCm39) T79A probably benign Het
Adipoq A C 16: 22,973,988 (GRCm39) Q26P unknown Het
Afg2a T C 3: 37,493,334 (GRCm39) F515L probably damaging Het
Akap13 T A 7: 75,333,199 (GRCm39) N1582K possibly damaging Het
Alg9 A G 9: 50,690,396 (GRCm39) T133A probably benign Het
Anks3 T C 16: 4,765,158 (GRCm39) T418A probably benign Het
Ano3 A C 2: 110,591,800 (GRCm39) L37R probably damaging Het
Ano9 A G 7: 140,688,291 (GRCm39) F178L possibly damaging Het
Arhgef12 A G 9: 42,916,838 (GRCm39) probably null Het
Arl16 T A 11: 120,356,589 (GRCm39) I137F possibly damaging Het
Brpf1 T A 6: 113,296,892 (GRCm39) S959T possibly damaging Het
Ccdc27 C T 4: 154,126,222 (GRCm39) R89Q unknown Het
Cd109 A C 9: 78,611,006 (GRCm39) Q1207H probably benign Het
Cd14 A T 18: 36,858,357 (GRCm39) V366D possibly damaging Het
Cep290 G A 10: 100,346,435 (GRCm39) V538I probably benign Het
Cep57 G A 9: 13,727,364 (GRCm39) A202V probably damaging Het
Chl1 T C 6: 103,624,292 (GRCm39) probably null Het
Cmah T G 13: 24,601,282 (GRCm39) F29L probably benign Het
Cracd G T 5: 77,015,052 (GRCm39) A42S possibly damaging Het
Crybg1 A G 10: 43,868,544 (GRCm39) V1378A possibly damaging Het
Cryzl2 A G 1: 157,298,292 (GRCm39) K227R probably benign Het
D130043K22Rik T G 13: 25,066,585 (GRCm39) V794G possibly damaging Het
Ddx4 T A 13: 112,736,436 (GRCm39) T645S probably benign Het
Dhcr7 C T 7: 143,401,195 (GRCm39) R453C possibly damaging Het
Dhx8 T C 11: 101,643,189 (GRCm39) Y754H possibly damaging Het
Dnah7a T C 1: 53,472,046 (GRCm39) probably null Het
Dst A G 1: 34,330,980 (GRCm39) D6937G probably damaging Het
Dusp1 A G 17: 26,726,081 (GRCm39) I204T probably damaging Het
Dync2h1 T A 9: 7,128,256 (GRCm39) Q1859L probably damaging Het
E4f1 C A 17: 24,665,558 (GRCm39) G328V probably damaging Het
Eml5 T C 12: 98,765,098 (GRCm39) Y1617C probably damaging Het
Espn G T 4: 152,212,686 (GRCm39) P622Q probably damaging Het
Fam184b G A 5: 45,741,676 (GRCm39) P185L possibly damaging Het
Fn1 T A 1: 71,676,542 (GRCm39) D563V probably damaging Het
Gad2 A G 2: 22,580,219 (GRCm39) Y540C probably benign Het
Garin1b T C 6: 29,334,152 (GRCm39) S335P possibly damaging Het
Gdf11 T C 10: 128,727,163 (GRCm39) D131G probably damaging Het
Gm19965 T A 1: 116,748,989 (GRCm39) Y223* probably null Het
H2-M10.6 A G 17: 37,123,076 (GRCm39) K3R probably benign Het
Hid1 A G 11: 115,239,336 (GRCm39) Y776H probably damaging Het
Hivep3 A T 4: 119,956,034 (GRCm39) K1450I probably damaging Het
Icam5 T C 9: 20,944,821 (GRCm39) L128P possibly damaging Het
Idnk T C 13: 58,305,526 (GRCm39) V9A probably damaging Het
Il4ra A T 7: 125,166,354 (GRCm39) T33S possibly damaging Het
Ino80 A G 2: 119,248,890 (GRCm39) V990A probably benign Het
Krtap4-9 T C 11: 99,676,396 (GRCm39) probably benign Het
Lrrk2 A G 15: 91,664,184 (GRCm39) I1974V possibly damaging Het
Mcm3ap C T 10: 76,306,994 (GRCm39) A369V probably benign Het
Nek6 A G 2: 38,472,431 (GRCm39) M252V probably benign Het
Nfasc T A 1: 132,538,577 (GRCm39) I443F probably damaging Het
Nme8 T G 13: 19,881,206 (GRCm39) M1L probably damaging Het
Npnt T A 3: 132,610,454 (GRCm39) Q423L possibly damaging Het
Nup133 A T 8: 124,657,722 (GRCm39) C404* probably null Het
Or2b7 T C 13: 21,739,982 (GRCm39) D70G probably damaging Het
Or4c124 A G 2: 89,156,086 (GRCm39) V146A probably benign Het
Or4f14b A G 2: 111,775,204 (GRCm39) V199A possibly damaging Het
Or56a4 T C 7: 104,806,190 (GRCm39) E233G probably benign Het
Or5an1c T C 19: 12,219,023 (GRCm39) M1V probably null Het
Or6c213 A G 10: 129,574,312 (GRCm39) L158S probably damaging Het
Otog T A 7: 45,937,583 (GRCm39) I1764N probably benign Het
Oxa1l A G 14: 54,600,909 (GRCm39) I127M probably benign Het
P4hb C A 11: 120,463,552 (GRCm39) V28F probably damaging Het
Pbld2 C T 10: 62,890,150 (GRCm39) A186V probably benign Het
Pdzph1 G T 17: 59,281,808 (GRCm39) T158K probably damaging Het
Pgm2 T A 5: 64,265,194 (GRCm39) probably null Het
Phip A T 9: 82,758,242 (GRCm39) S1484T probably benign Het
Pikfyve T C 1: 65,231,430 (GRCm39) L100P probably damaging Het
Pikfyve T C 1: 65,285,529 (GRCm39) S923P probably benign Het
Pla2g4e A G 2: 120,075,202 (GRCm39) S63P probably benign Het
Plekhh2 A G 17: 84,906,693 (GRCm39) E1176G probably damaging Het
Prlr T A 15: 10,325,404 (GRCm39) Y192* probably null Het
Pten T A 19: 32,775,472 (GRCm39) C71S probably damaging Het
Rbbp8nl A G 2: 179,922,987 (GRCm39) L202P probably benign Het
Ripor2 T A 13: 24,885,237 (GRCm39) S491T probably benign Het
Robo1 A T 16: 72,801,399 (GRCm39) I1008F probably benign Het
Scg2 T C 1: 79,413,352 (GRCm39) N417S probably benign Het
Scn8a A G 15: 100,937,496 (GRCm39) I1581V probably damaging Het
Slc22a8 T A 19: 8,571,593 (GRCm39) I108N probably damaging Het
Slc9a8 A T 2: 167,313,385 (GRCm39) T416S possibly damaging Het
Spata32 T A 11: 103,099,644 (GRCm39) E287V probably damaging Het
Tgfbrap1 C T 1: 43,114,512 (GRCm39) G196D probably damaging Het
Tgm5 G T 2: 120,908,131 (GRCm39) T15K possibly damaging Het
Tmc1 C T 19: 20,803,865 (GRCm39) probably null Het
Tmem177 T C 1: 119,838,306 (GRCm39) I124M possibly damaging Het
Trim30a A G 7: 104,085,108 (GRCm39) F34S probably damaging Het
Tsn T C 1: 118,232,969 (GRCm39) T112A probably benign Het
Tspyl5 T G 15: 33,686,922 (GRCm39) N341T probably benign Het
Vmn2r108 C T 17: 20,689,335 (GRCm39) C540Y probably damaging Het
Vrtn C T 12: 84,696,998 (GRCm39) R583W probably damaging Het
Wnt1 T C 15: 98,689,638 (GRCm39) S142P probably damaging Het
Wrn A T 8: 33,833,589 (GRCm39) I108N probably damaging Het
Zfhx2 A C 14: 55,310,348 (GRCm39) C733G possibly damaging Het
Zfp219 T C 14: 52,244,563 (GRCm39) T539A probably damaging Het
Zswim8 T A 14: 20,761,598 (GRCm39) M177K probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTAAGTGACTCCCCTGACAATG -3'
(R):5'- ACTGCTCTCCGAGTCTCCTCAAAG -3'

Sequencing Primer
(F):5'- TGACAATGTCCTCTGTCTCATAG -3'
(R):5'- TCTCCTCAAAGACTTGGAGGC -3'
Posted On 2014-05-23