Incidental Mutation 'R1774:Iqca'
ID196882
Institutional Source Beutler Lab
Gene Symbol Iqca
Ensembl Gene ENSMUSG00000026301
Gene NameIQ motif containing with AAA domain
Synonyms
MMRRC Submission 039805-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1774 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location90042132-90153401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90080903 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 456 (N456S)
Ref Sequence ENSEMBL: ENSMUSP00000108717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113094] [ENSMUST00000212394]
Predicted Effect probably benign
Transcript: ENSMUST00000113094
AA Change: N456S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108717
Gene: ENSMUSG00000026301
AA Change: N456S

DomainStartEndE-ValueType
IQ 205 227 6.97e0 SMART
coiled coil region 340 380 N/A INTRINSIC
coiled coil region 425 450 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
AAA 567 706 1.08e-3 SMART
low complexity region 812 829 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189690
Predicted Effect probably benign
Transcript: ENSMUST00000212394
AA Change: N465S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ATPases Associated with diverse cellular Activities (AAA) superfamily. Members of this superfamily, found in all organisms, participate in a large number of cellular processes and contain the ATPase module consisting of an alpha-beta-alpha core domain and the Walker A and B motifs of the P-loop NTPases. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,045,541 V312A probably damaging Het
2810408A11Rik A G 11: 69,900,627 V42A probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Angpt1 T A 15: 42,523,616 Q114L probably damaging Het
Apc2 T C 10: 80,309,130 I625T probably damaging Het
Atg2a T C 19: 6,250,598 V735A probably benign Het
Birc6 T A 17: 74,640,013 I2909N probably damaging Het
C7 C G 15: 5,012,075 D450H probably damaging Het
Cachd1 C T 4: 100,964,435 T403I probably damaging Het
Cachd1 T A 4: 100,967,043 F560L probably benign Het
Cacna2d2 A T 9: 107,526,151 Y944F probably benign Het
Cdkal1 C T 13: 29,850,048 D21N probably damaging Het
Col18a1 T C 10: 77,059,981 R901G probably damaging Het
Col27a1 C T 4: 63,225,713 P546L probably damaging Het
Cps1 C T 1: 67,170,882 R624W possibly damaging Het
Cyp11a1 A T 9: 58,018,360 I93F probably benign Het
Cyp2c40 G C 19: 39,786,806 T334R probably damaging Het
Cyp4f37 A G 17: 32,629,890 D244G possibly damaging Het
D630003M21Rik A T 2: 158,220,470 D43E probably damaging Het
Ep400 C A 5: 110,685,491 C1955F unknown Het
Ethe1 G A 7: 24,593,946 V6I probably benign Het
F5 C A 1: 164,192,535 Q860K probably benign Het
Fasn T C 11: 120,817,171 Y685C probably damaging Het
Gga2 T G 7: 122,012,221 D38A probably damaging Het
Gm12794 G A 4: 101,940,458 V18M probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm43302 T A 5: 105,275,794 I438F probably benign Het
Grm1 T A 10: 11,079,866 T225S possibly damaging Het
Hic2 G T 16: 17,258,647 V447L probably damaging Het
Hsf2 G A 10: 57,512,146 C462Y probably damaging Het
Ice1 T C 13: 70,604,553 D1138G probably damaging Het
Il6 A G 5: 30,019,435 T158A probably benign Het
Inpp5d T A 1: 87,667,889 V120E probably benign Het
Itgal T A 7: 127,309,622 probably null Het
Lrrc66 G C 5: 73,610,855 Q248E probably benign Het
Lrrc7 T A 3: 158,160,292 M1271L possibly damaging Het
Lrrc74a T C 12: 86,749,053 S267P probably damaging Het
Map2 T C 1: 66,414,074 S550P probably damaging Het
Mapk8ip3 A T 17: 24,924,145 probably null Het
Mdm4 A C 1: 132,996,646 S246A probably damaging Het
Med23 A G 10: 24,903,686 E887G probably damaging Het
Mgea5 T C 19: 45,776,984 E128G probably benign Het
Mta1 C T 12: 113,128,039 A254V probably damaging Het
Myh2 A G 11: 67,173,474 Y85C possibly damaging Het
Myo1g A G 11: 6,515,988 Y366H probably damaging Het
Nalcn G A 14: 123,278,266 P1708S probably benign Het
Nlrp9c A T 7: 26,394,118 S41T probably benign Het
Nptx2 T A 5: 144,553,438 S226T possibly damaging Het
Nup85 T A 11: 115,582,945 S562T probably benign Het
Nxpe5 T C 5: 138,239,535 V107A probably benign Het
Olfr129 A G 17: 38,055,437 V43A probably benign Het
Olfr273 T A 4: 52,855,674 I280F probably benign Het
Olfr414 A G 1: 174,431,339 T304A probably benign Het
Olfr455 A T 6: 42,538,519 F168I probably damaging Het
Pcdhb12 C T 18: 37,436,442 P214S possibly damaging Het
Pcdhb5 T A 18: 37,322,672 F702I probably damaging Het
Pcnx T C 12: 81,975,320 F1475S probably damaging Het
Pde5a C A 3: 122,729,364 T40N probably benign Het
Pnpla2 T A 7: 141,459,568 V398E probably damaging Het
Rab20 T C 8: 11,454,223 K159R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rgs12 T A 5: 34,966,403 V510D probably benign Het
Rnf219 A G 14: 104,479,662 V425A possibly damaging Het
Slamf6 T C 1: 171,942,587 probably benign Het
Slc27a5 A T 7: 12,997,607 C23* probably null Het
Slc35e2 T C 4: 155,610,164 V56A possibly damaging Het
Slx4ip T C 2: 137,067,723 S143P probably damaging Het
Stat5a C T 11: 100,879,286 S463F probably damaging Het
Svep1 T C 4: 58,146,562 D360G possibly damaging Het
Tas2r143 A T 6: 42,400,371 D45V probably damaging Het
Tdrd5 G T 1: 156,277,509 R516S probably damaging Het
Thy1 A G 9: 44,047,339 D126G probably benign Het
Tspear C T 10: 77,873,185 T415I probably benign Het
Ttll5 C A 12: 85,933,402 T920K probably benign Het
Umod T C 7: 119,477,351 E64G possibly damaging Het
Usf3 A G 16: 44,215,670 N171S probably damaging Het
Vmn1r23 T A 6: 57,926,690 R34S probably damaging Het
Wasf1 C G 10: 40,934,479 P239R possibly damaging Het
Wdr95 C T 5: 149,564,392 R164* probably null Het
Zan C A 5: 137,419,989 C2949F unknown Het
Zbed4 T C 15: 88,780,877 S383P probably benign Het
Zcchc11 T C 4: 108,507,955 F542L probably damaging Het
Zfand5 T A 19: 21,276,531 C33S probably damaging Het
Zfp12 A G 5: 143,245,229 Y437C probably damaging Het
Zfp451 A C 1: 33,813,768 S22A probably benign Het
Other mutations in Iqca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Iqca APN 1 90045657 missense probably benign 0.10
IGL01367:Iqca APN 1 90070628 splice site probably benign
IGL01545:Iqca APN 1 90045642 missense probably benign
IGL01797:Iqca APN 1 90144819 critical splice donor site probably null
IGL02098:Iqca APN 1 90047941 missense probably damaging 0.96
IGL02194:Iqca APN 1 90045663 missense probably benign 0.16
IGL03230:Iqca APN 1 90145002 missense probably damaging 1.00
IGL03259:Iqca APN 1 90052434 missense probably damaging 1.00
IGL03372:Iqca APN 1 90144969 missense possibly damaging 0.80
R0383:Iqca UTSW 1 90142707 missense probably damaging 1.00
R0610:Iqca UTSW 1 90142731 missense probably null 0.97
R0685:Iqca UTSW 1 90142731 missense probably null 0.97
R0798:Iqca UTSW 1 90142731 missense probably null 0.97
R0799:Iqca UTSW 1 90142731 missense probably null 0.97
R0800:Iqca UTSW 1 90142731 missense probably null 0.97
R0801:Iqca UTSW 1 90142731 missense probably null 0.97
R0825:Iqca UTSW 1 90142731 missense probably null 0.97
R0826:Iqca UTSW 1 90142731 missense probably null 0.97
R0827:Iqca UTSW 1 90142731 missense probably null 0.97
R0862:Iqca UTSW 1 90142731 missense probably null 0.97
R0863:Iqca UTSW 1 90142731 missense probably null 0.97
R0864:Iqca UTSW 1 90142731 missense probably null 0.97
R0960:Iqca UTSW 1 90142731 missense probably null 0.97
R0961:Iqca UTSW 1 90142731 missense probably null 0.97
R0962:Iqca UTSW 1 90142731 missense probably null 0.97
R0963:Iqca UTSW 1 90142731 missense probably null 0.97
R1101:Iqca UTSW 1 90142731 missense probably null 0.97
R1344:Iqca UTSW 1 90142731 missense probably null 0.97
R1523:Iqca UTSW 1 90142731 missense probably null 0.97
R1646:Iqca UTSW 1 90140038 missense probably damaging 0.98
R1682:Iqca UTSW 1 90142731 missense probably null 0.97
R1742:Iqca UTSW 1 90098051 missense probably benign 0.01
R1775:Iqca UTSW 1 90081416 missense probably damaging 1.00
R2011:Iqca UTSW 1 90045626 missense probably benign 0.00
R2065:Iqca UTSW 1 90130231 missense probably benign 0.01
R2156:Iqca UTSW 1 90089516 missense possibly damaging 0.78
R2186:Iqca UTSW 1 90081344 missense probably benign 0.06
R3872:Iqca UTSW 1 90089481 missense probably damaging 1.00
R4308:Iqca UTSW 1 90144897 missense probably damaging 1.00
R4578:Iqca UTSW 1 90073750 missense probably damaging 0.98
R4737:Iqca UTSW 1 90077822 missense probably damaging 0.99
R4867:Iqca UTSW 1 90089504 missense probably benign 0.00
R4884:Iqca UTSW 1 90140037 missense probably benign 0.10
R4887:Iqca UTSW 1 90045701 missense probably damaging 1.00
R5352:Iqca UTSW 1 90130196 missense probably benign 0.00
R5733:Iqca UTSW 1 90070535 missense probably damaging 0.97
R5838:Iqca UTSW 1 90144945 missense probably benign 0.22
R5951:Iqca UTSW 1 90140097 intron probably null
R5957:Iqca UTSW 1 90080948 missense probably damaging 1.00
R6696:Iqca UTSW 1 90130200 missense probably benign
R7240:Iqca UTSW 1 90070550 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTGGGCACTGGGTGATGAACAG -3'
(R):5'- ACAGGGGATGCCATTTACTGCAAC -3'

Sequencing Primer
(F):5'- ccatacctctcaatccttccc -3'
(R):5'- CTGCAACAACTAGACTTTTTACAGC -3'
Posted On2014-05-23