Incidental Mutation 'R0081:Cyfip2'
ID19689
Institutional Source Beutler Lab
Gene Symbol Cyfip2
Ensembl Gene ENSMUSG00000020340
Gene Namecytoplasmic FMR1 interacting protein 2
Synonyms1500004I01Rik, Pir121, 6430511D02Rik
MMRRC Submission 038368-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0081 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location46193850-46312859 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 46253998 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 676 (Y676*)
Ref Sequence ENSEMBL: ENSMUSP00000127586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093165] [ENSMUST00000093166] [ENSMUST00000165599]
Predicted Effect probably null
Transcript: ENSMUST00000093165
AA Change: Y676*
SMART Domains Protein: ENSMUSP00000090853
Gene: ENSMUSG00000020340
AA Change: Y676*

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 59 303 5.4e-12 PFAM
Pfam:FragX_IP 388 1221 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000093166
AA Change: Y676*
SMART Domains Protein: ENSMUSP00000090854
Gene: ENSMUSG00000020340
AA Change: Y676*

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 384 1223 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000142017
AA Change: Y370*
SMART Domains Protein: ENSMUSP00000119801
Gene: ENSMUSG00000020340
AA Change: Y370*

DomainStartEndE-ValueType
Pfam:FragX_IP 58 230 4e-66 PFAM
Pfam:FragX_IP 246 916 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165599
AA Change: Y676*
SMART Domains Protein: ENSMUSP00000127586
Gene: ENSMUSG00000020340
AA Change: Y676*

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 384 1223 N/A PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.2%
  • 10x: 88.5%
  • 20x: 63.6%
Validation Efficiency 94% (159/169)
MGI Phenotype PHENOTYPE: Mice homozygous for knock-out allele exhibit complete neonatal lethality. Mice homozygous for a dominant spontaneous mutation exhibit impaired behavioral response to cocaine, fewer dendritic spines and reduced miniature excitatory postsynaptic current frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T C 8: 24,781,687 D485G probably damaging Het
Adamts19 T C 18: 58,903,065 probably null Het
Adgrd1 A T 5: 129,178,082 I598F probably damaging Het
Adh5 A G 3: 138,451,413 D245G probably benign Het
Adra2b T C 2: 127,364,292 V238A probably benign Het
Ank1 G A 8: 23,116,242 V1188I possibly damaging Het
Asap1 C T 15: 64,099,564 G905D probably damaging Het
AW554918 T C 18: 25,344,902 V428A probably benign Het
Birc6 T A 17: 74,643,441 S3226T probably benign Het
Cdh17 A T 4: 11,785,280 probably benign Het
Dcaf17 T A 2: 71,078,468 probably benign Het
Dclre1a A G 19: 56,542,707 F736L probably damaging Het
Ddx41 A T 13: 55,535,380 H171Q possibly damaging Het
Dennd5b G T 6: 148,993,759 Q1258K probably benign Het
Dock10 T C 1: 80,606,578 D137G probably damaging Het
Dpyd G A 3: 118,944,255 V482I probably benign Het
Erich6 A T 3: 58,636,126 probably benign Het
Fam193b A G 13: 55,554,211 probably benign Het
Foxp2 T C 6: 15,405,644 probably benign Het
Frmd4a T C 2: 4,572,441 probably null Het
Gas2l2 A G 11: 83,422,867 S540P possibly damaging Het
Glis2 T C 16: 4,613,653 V348A probably benign Het
Gm14443 C A 2: 175,169,936 G239V probably damaging Het
Gpr158 T C 2: 21,826,717 V876A probably damaging Het
H1foo A G 6: 115,949,981 E273G probably benign Het
Hadh C T 3: 131,235,636 D245N probably damaging Het
Hk2 A T 6: 82,734,976 probably benign Het
Ice1 A T 13: 70,619,044 Y108* probably null Het
Il10ra T G 9: 45,255,949 M435L probably benign Het
Inpp5k GT G 11: 75,631,147 probably null Het
Kank4 G T 4: 98,778,330 P627T probably benign Het
Kif16b A G 2: 142,707,426 probably benign Het
Lipn A G 19: 34,076,976 I205V probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myh1 T C 11: 67,215,857 M1255T probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo1d T G 11: 80,557,523 K925N probably benign Het
Myoz1 T A 14: 20,649,554 M239L probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nf1 C A 11: 79,453,979 probably benign Het
Npepl1 C T 2: 174,116,086 P239S probably damaging Het
Olfml1 A G 7: 107,571,299 K131R probably benign Het
Olfr1258 T A 2: 89,930,079 I90K possibly damaging Het
Olfr1303 A C 2: 111,813,868 I286S probably damaging Het
Olfr344 T A 2: 36,568,881 Y94* probably null Het
Olfr352 T C 2: 36,870,010 L148S possibly damaging Het
Olfr358 G A 2: 37,005,450 L55F probably damaging Het
Olfr389 A G 11: 73,777,109 F73L possibly damaging Het
Olfr472 C T 7: 107,903,005 T96I probably benign Het
Olfr771 C T 10: 129,160,838 D49N possibly damaging Het
Pde7a T C 3: 19,241,533 probably benign Het
Pik3c2g T C 6: 139,957,793 C591R probably benign Het
Pkn2 T G 3: 142,853,582 K61Q probably damaging Het
Ppfia1 C A 7: 144,504,974 G722C probably damaging Het
Ppp1cb T C 5: 32,487,614 V263A probably damaging Het
Rab11fip2 A T 19: 59,907,135 N440K possibly damaging Het
Rbm34 T A 8: 126,949,484 K340N probably damaging Het
Samd3 T C 10: 26,271,501 probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sigirr T C 7: 141,091,372 D399G probably damaging Het
Slc17a7 A G 7: 45,174,947 E554G probably benign Het
Smc3 A G 19: 53,601,562 probably benign Het
Tdrd1 T C 19: 56,831,271 Y68H probably benign Het
Tespa1 T A 10: 130,360,850 L219Q probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Ttc38 A G 15: 85,856,472 S436G probably benign Het
Ttn T A 2: 76,751,079 I23157F probably damaging Het
Ubxn2b T A 4: 6,203,875 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r72 T C 7: 85,751,836 E125G probably benign Het
Vmn2r78 A T 7: 86,923,027 D532V probably benign Het
Vwa8 C A 14: 79,082,782 L1078I probably benign Het
Vwce A T 19: 10,664,089 probably null Het
Zpr1 A G 9: 46,279,697 D300G probably damaging Het
Other mutations in Cyfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Cyfip2 APN 11 46200685 missense possibly damaging 0.74
IGL01352:Cyfip2 APN 11 46265996 missense probably benign 0.01
IGL01685:Cyfip2 APN 11 46207488 splice site probably benign
IGL02367:Cyfip2 APN 11 46276905 nonsense probably null
IGL02390:Cyfip2 APN 11 46221398 missense possibly damaging 0.58
IGL02471:Cyfip2 APN 11 46200803 missense possibly damaging 0.58
IGL02583:Cyfip2 APN 11 46249758 missense possibly damaging 0.56
IGL03199:Cyfip2 APN 11 46276843 missense probably benign 0.07
IGL02835:Cyfip2 UTSW 11 46249771 missense probably benign 0.00
R0288:Cyfip2 UTSW 11 46253972 missense possibly damaging 0.94
R1830:Cyfip2 UTSW 11 46199019 missense probably damaging 1.00
R1869:Cyfip2 UTSW 11 46224168 missense probably benign 0.40
R1989:Cyfip2 UTSW 11 46253998 nonsense probably null
R2045:Cyfip2 UTSW 11 46249789 missense probably benign 0.00
R2101:Cyfip2 UTSW 11 46242443 missense probably damaging 1.00
R2131:Cyfip2 UTSW 11 46286131 missense possibly damaging 0.78
R2162:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R2299:Cyfip2 UTSW 11 46286131 missense probably benign 0.02
R3831:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3832:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3833:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3881:Cyfip2 UTSW 11 46208335 missense probably damaging 1.00
R4127:Cyfip2 UTSW 11 46270647 missense probably benign 0.00
R4385:Cyfip2 UTSW 11 46242403 missense probably benign 0.05
R4617:Cyfip2 UTSW 11 46254018 missense probably damaging 1.00
R4739:Cyfip2 UTSW 11 46279993 missense probably damaging 0.99
R5232:Cyfip2 UTSW 11 46242378 missense probably damaging 1.00
R5365:Cyfip2 UTSW 11 46247630 missense probably damaging 0.99
R5383:Cyfip2 UTSW 11 46278091 missense possibly damaging 0.83
R5447:Cyfip2 UTSW 11 46291586 missense possibly damaging 0.72
R5450:Cyfip2 UTSW 11 46284252 missense probably benign 0.00
R5796:Cyfip2 UTSW 11 46198996 missense probably benign 0.01
R5820:Cyfip2 UTSW 11 46200704 missense probably damaging 1.00
R5925:Cyfip2 UTSW 11 46207436 missense probably damaging 1.00
R6143:Cyfip2 UTSW 11 46253965 nonsense probably null
R6321:Cyfip2 UTSW 11 46291520 missense probably benign 0.01
R6502:Cyfip2 UTSW 11 46221346 missense probably damaging 1.00
R6511:Cyfip2 UTSW 11 46196308 missense probably benign 0.00
R6521:Cyfip2 UTSW 11 46254588 missense probably damaging 1.00
R6660:Cyfip2 UTSW 11 46249807 missense possibly damaging 0.89
R6836:Cyfip2 UTSW 11 46272640 missense probably benign 0.16
R6866:Cyfip2 UTSW 11 46242459 nonsense probably null
R7062:Cyfip2 UTSW 11 46260832 missense probably damaging 1.00
R7192:Cyfip2 UTSW 11 46254666 missense probably benign 0.21
R7231:Cyfip2 UTSW 11 46224136 missense probably benign
R7258:Cyfip2 UTSW 11 46224177 missense probably benign 0.02
R7365:Cyfip2 UTSW 11 46207440 nonsense probably null
R7441:Cyfip2 UTSW 11 46196427 missense possibly damaging 0.80
R7561:Cyfip2 UTSW 11 46270598 missense probably benign 0.00
R7831:Cyfip2 UTSW 11 46196446 missense probably damaging 1.00
R7871:Cyfip2 UTSW 11 46242350 missense probably damaging 1.00
R7914:Cyfip2 UTSW 11 46196446 missense probably damaging 1.00
R7954:Cyfip2 UTSW 11 46242350 missense probably damaging 1.00
Z1176:Cyfip2 UTSW 11 46222615 missense not run
Z1177:Cyfip2 UTSW 11 46222615 missense not run
Predicted Primers PCR Primer
(F):5'- TCCTTGAAGCCCCTCATGGTGTAG -3'
(R):5'- AGAGGGAGGGAGCTTGTCTTCAAC -3'

Sequencing Primer
(F):5'- CAGTATTATGTTTGACAGCCCCAG -3'
(R):5'- GTCTTCAACTCCAAGCCATCTG -3'
Posted On2013-04-11