Incidental Mutation 'R1774:Lrrc66'
ID196907
Institutional Source Beutler Lab
Gene Symbol Lrrc66
Ensembl Gene ENSMUSG00000067206
Gene Nameleucine rich repeat containing 66
SynonymsMGC:38937
MMRRC Submission 039805-MU
Accession Numbers

Genbank: NM_153568; MGI: 2387634

Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1774 (G1)
Quality Score223
Status Not validated
Chromosome5
Chromosomal Location73606642-73632526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 73610855 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 248 (Q248E)
Ref Sequence ENSEMBL: ENSMUSP00000084423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087177]
Predicted Effect probably benign
Transcript: ENSMUST00000087177
AA Change: Q248E

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000084423
Gene: ENSMUSG00000067206
AA Change: Q248E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRR 140 162 1.81e1 SMART
LRR_TYP 163 186 9.44e-2 SMART
LRR 187 210 1.26e2 SMART
LRR 211 234 4.84e1 SMART
low complexity region 298 309 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 842 859 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,045,541 V312A probably damaging Het
2810408A11Rik A G 11: 69,900,627 V42A probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Angpt1 T A 15: 42,523,616 Q114L probably damaging Het
Apc2 T C 10: 80,309,130 I625T probably damaging Het
Atg2a T C 19: 6,250,598 V735A probably benign Het
Birc6 T A 17: 74,640,013 I2909N probably damaging Het
C7 C G 15: 5,012,075 D450H probably damaging Het
Cachd1 C T 4: 100,964,435 T403I probably damaging Het
Cachd1 T A 4: 100,967,043 F560L probably benign Het
Cacna2d2 A T 9: 107,526,151 Y944F probably benign Het
Cdkal1 C T 13: 29,850,048 D21N probably damaging Het
Col18a1 T C 10: 77,059,981 R901G probably damaging Het
Col27a1 C T 4: 63,225,713 P546L probably damaging Het
Cps1 C T 1: 67,170,882 R624W possibly damaging Het
Cyp11a1 A T 9: 58,018,360 I93F probably benign Het
Cyp2c40 G C 19: 39,786,806 T334R probably damaging Het
Cyp4f37 A G 17: 32,629,890 D244G possibly damaging Het
D630003M21Rik A T 2: 158,220,470 D43E probably damaging Het
Ep400 C A 5: 110,685,491 C1955F unknown Het
Ethe1 G A 7: 24,593,946 V6I probably benign Het
F5 C A 1: 164,192,535 Q860K probably benign Het
Fasn T C 11: 120,817,171 Y685C probably damaging Het
Gga2 T G 7: 122,012,221 D38A probably damaging Het
Gm12794 G A 4: 101,940,458 V18M probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm43302 T A 5: 105,275,794 I438F probably benign Het
Grm1 T A 10: 11,079,866 T225S possibly damaging Het
Hic2 G T 16: 17,258,647 V447L probably damaging Het
Hsf2 G A 10: 57,512,146 C462Y probably damaging Het
Ice1 T C 13: 70,604,553 D1138G probably damaging Het
Il6 A G 5: 30,019,435 T158A probably benign Het
Inpp5d T A 1: 87,667,889 V120E probably benign Het
Iqca T C 1: 90,080,903 N456S probably benign Het
Itgal T A 7: 127,309,622 probably null Het
Lrrc7 T A 3: 158,160,292 M1271L possibly damaging Het
Lrrc74a T C 12: 86,749,053 S267P probably damaging Het
Map2 T C 1: 66,414,074 S550P probably damaging Het
Mapk8ip3 A T 17: 24,924,145 probably null Het
Mdm4 A C 1: 132,996,646 S246A probably damaging Het
Med23 A G 10: 24,903,686 E887G probably damaging Het
Mgea5 T C 19: 45,776,984 E128G probably benign Het
Mta1 C T 12: 113,128,039 A254V probably damaging Het
Myh2 A G 11: 67,173,474 Y85C possibly damaging Het
Myo1g A G 11: 6,515,988 Y366H probably damaging Het
Nalcn G A 14: 123,278,266 P1708S probably benign Het
Nlrp9c A T 7: 26,394,118 S41T probably benign Het
Nptx2 T A 5: 144,553,438 S226T possibly damaging Het
Nup85 T A 11: 115,582,945 S562T probably benign Het
Nxpe5 T C 5: 138,239,535 V107A probably benign Het
Olfr129 A G 17: 38,055,437 V43A probably benign Het
Olfr273 T A 4: 52,855,674 I280F probably benign Het
Olfr414 A G 1: 174,431,339 T304A probably benign Het
Olfr455 A T 6: 42,538,519 F168I probably damaging Het
Pcdhb12 C T 18: 37,436,442 P214S possibly damaging Het
Pcdhb5 T A 18: 37,322,672 F702I probably damaging Het
Pcnx T C 12: 81,975,320 F1475S probably damaging Het
Pde5a C A 3: 122,729,364 T40N probably benign Het
Pnpla2 T A 7: 141,459,568 V398E probably damaging Het
Rab20 T C 8: 11,454,223 K159R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rgs12 T A 5: 34,966,403 V510D probably benign Het
Rnf219 A G 14: 104,479,662 V425A possibly damaging Het
Slamf6 T C 1: 171,942,587 probably benign Het
Slc27a5 A T 7: 12,997,607 C23* probably null Het
Slc35e2 T C 4: 155,610,164 V56A possibly damaging Het
Slx4ip T C 2: 137,067,723 S143P probably damaging Het
Stat5a C T 11: 100,879,286 S463F probably damaging Het
Svep1 T C 4: 58,146,562 D360G possibly damaging Het
Tas2r143 A T 6: 42,400,371 D45V probably damaging Het
Tdrd5 G T 1: 156,277,509 R516S probably damaging Het
Thy1 A G 9: 44,047,339 D126G probably benign Het
Tspear C T 10: 77,873,185 T415I probably benign Het
Ttll5 C A 12: 85,933,402 T920K probably benign Het
Umod T C 7: 119,477,351 E64G possibly damaging Het
Usf3 A G 16: 44,215,670 N171S probably damaging Het
Vmn1r23 T A 6: 57,926,690 R34S probably damaging Het
Wasf1 C G 10: 40,934,479 P239R possibly damaging Het
Wdr95 C T 5: 149,564,392 R164* probably null Het
Zan C A 5: 137,419,989 C2949F unknown Het
Zbed4 T C 15: 88,780,877 S383P probably benign Het
Zcchc11 T C 4: 108,507,955 F542L probably damaging Het
Zfand5 T A 19: 21,276,531 C33S probably damaging Het
Zfp12 A G 5: 143,245,229 Y437C probably damaging Het
Zfp451 A C 1: 33,813,768 S22A probably benign Het
Other mutations in Lrrc66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Lrrc66 APN 5 73607114 missense probably benign 0.10
IGL00913:Lrrc66 APN 5 73608156 missense possibly damaging 0.76
IGL00954:Lrrc66 APN 5 73608398 missense possibly damaging 0.94
IGL01061:Lrrc66 APN 5 73615499 missense probably benign 0.01
IGL01343:Lrrc66 APN 5 73608463 missense probably damaging 0.98
IGL01714:Lrrc66 APN 5 73629977 missense probably benign 0.10
IGL01822:Lrrc66 APN 5 73629968 missense probably benign 0.17
IGL02005:Lrrc66 APN 5 73608734 missense possibly damaging 0.83
IGL02166:Lrrc66 APN 5 73607291 missense probably damaging 0.99
IGL02380:Lrrc66 APN 5 73629666 missense possibly damaging 0.55
IGL03162:Lrrc66 APN 5 73607382 missense probably benign
D4043:Lrrc66 UTSW 5 73607526 missense probably benign 0.03
R0126:Lrrc66 UTSW 5 73607088 missense probably benign 0.10
R0437:Lrrc66 UTSW 5 73607687 missense probably benign 0.23
R0638:Lrrc66 UTSW 5 73615473 splice site probably benign
R0658:Lrrc66 UTSW 5 73610944 missense probably benign 0.40
R0729:Lrrc66 UTSW 5 73608414 missense probably benign
R1603:Lrrc66 UTSW 5 73607426 missense possibly damaging 0.61
R1831:Lrrc66 UTSW 5 73607426 missense possibly damaging 0.61
R1832:Lrrc66 UTSW 5 73607426 missense possibly damaging 0.61
R1902:Lrrc66 UTSW 5 73607622 missense probably damaging 0.99
R2858:Lrrc66 UTSW 5 73607303 missense probably benign 0.08
R4097:Lrrc66 UTSW 5 73607704 missense possibly damaging 0.94
R4164:Lrrc66 UTSW 5 73629776 unclassified probably null
R4582:Lrrc66 UTSW 5 73608237 missense possibly damaging 0.94
R4708:Lrrc66 UTSW 5 73629662 missense probably benign 0.06
R4856:Lrrc66 UTSW 5 73608567 missense probably benign 0.10
R4886:Lrrc66 UTSW 5 73608567 missense probably benign 0.10
R5074:Lrrc66 UTSW 5 73608011 missense probably damaging 1.00
R5464:Lrrc66 UTSW 5 73608279 missense probably benign 0.05
R5640:Lrrc66 UTSW 5 73608634 missense probably benign 0.00
R5709:Lrrc66 UTSW 5 73608863 missense probably benign
R5811:Lrrc66 UTSW 5 73615517 missense possibly damaging 0.82
R6146:Lrrc66 UTSW 5 73608089 missense probably benign 0.10
R7037:Lrrc66 UTSW 5 73607161 missense probably benign 0.10
R7041:Lrrc66 UTSW 5 73608556 missense possibly damaging 0.81
R7141:Lrrc66 UTSW 5 73629977 missense probably benign 0.10
R7201:Lrrc66 UTSW 5 73629897 missense probably benign 0.11
R7250:Lrrc66 UTSW 5 73610881 missense probably benign 0.03
R7367:Lrrc66 UTSW 5 73608381 missense probably benign 0.13
R7773:Lrrc66 UTSW 5 73607321 missense probably damaging 0.98
R8057:Lrrc66 UTSW 5 73607532 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTGCTAACCTCTACAGTGTGACC -3'
(R):5'- GGGCTCCCAGAAAGCAAATGAGTTG -3'

Sequencing Primer
(F):5'- agaggaatagaacgatgactaagg -3'
(R):5'- AGCCATATCTCTGTATAACTCCgtg -3'
Posted On2014-05-23