Incidental Mutation 'R0081:Nf1'
ID 19692
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Name neurofibromin 1
Synonyms Mhdadsk9, Dsk9, neurofibromin, Nf-1
MMRRC Submission 038368-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0081 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 79230519-79472438 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 79344805 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000219057]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071325
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108251
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130979
Predicted Effect probably benign
Transcript: ENSMUST00000219057
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.2%
  • 10x: 88.5%
  • 20x: 63.6%
Validation Efficiency 94% (159/169)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T C 8: 25,271,703 (GRCm39) D485G probably damaging Het
Adamts19 T C 18: 59,036,137 (GRCm39) probably null Het
Adgrd1 A T 5: 129,255,146 (GRCm39) I598F probably damaging Het
Adh5 A G 3: 138,157,174 (GRCm39) D245G probably benign Het
Adra2b T C 2: 127,206,212 (GRCm39) V238A probably benign Het
Ank1 G A 8: 23,606,258 (GRCm39) V1188I possibly damaging Het
Asap1 C T 15: 63,971,413 (GRCm39) G905D probably damaging Het
AW554918 T C 18: 25,477,959 (GRCm39) V428A probably benign Het
Birc6 T A 17: 74,950,436 (GRCm39) S3226T probably benign Het
Cdh17 A T 4: 11,785,280 (GRCm39) probably benign Het
Cyfip2 A T 11: 46,144,825 (GRCm39) Y676* probably null Het
Dcaf17 T A 2: 70,908,812 (GRCm39) probably benign Het
Dclre1a A G 19: 56,531,139 (GRCm39) F736L probably damaging Het
Ddx41 A T 13: 55,683,193 (GRCm39) H171Q possibly damaging Het
Dennd5b G T 6: 148,895,257 (GRCm39) Q1258K probably benign Het
Dock10 T C 1: 80,584,295 (GRCm39) D137G probably damaging Het
Dpyd G A 3: 118,737,904 (GRCm39) V482I probably benign Het
Erich6 A T 3: 58,543,547 (GRCm39) probably benign Het
Fam193b A G 13: 55,702,024 (GRCm39) probably benign Het
Foxp2 T C 6: 15,405,643 (GRCm39) probably benign Het
Frmd4a T C 2: 4,577,252 (GRCm39) probably null Het
Gas2l2 A G 11: 83,313,693 (GRCm39) S540P possibly damaging Het
Glis2 T C 16: 4,431,517 (GRCm39) V348A probably benign Het
Gm14443 C A 2: 175,011,729 (GRCm39) G239V probably damaging Het
Gpr158 T C 2: 21,831,528 (GRCm39) V876A probably damaging Het
H1f8 A G 6: 115,926,942 (GRCm39) E273G probably benign Het
Hadh C T 3: 131,029,285 (GRCm39) D245N probably damaging Het
Hk2 A T 6: 82,711,957 (GRCm39) probably benign Het
Ice1 A T 13: 70,767,163 (GRCm39) Y108* probably null Het
Il10ra T G 9: 45,167,247 (GRCm39) M435L probably benign Het
Inpp5k GT G 11: 75,521,973 (GRCm39) probably null Het
Kank4 G T 4: 98,666,567 (GRCm39) P627T probably benign Het
Kif16b A G 2: 142,549,346 (GRCm39) probably benign Het
Lipn A G 19: 34,054,376 (GRCm39) I205V probably benign Het
Miox C T 15: 89,220,477 (GRCm39) L189F possibly damaging Het
Myh1 T C 11: 67,106,683 (GRCm39) M1255T probably benign Het
Myl3 A C 9: 110,596,997 (GRCm39) D119A probably damaging Het
Myo1d T G 11: 80,448,349 (GRCm39) K925N probably benign Het
Myoz1 T A 14: 20,699,622 (GRCm39) M239L probably benign Het
Ncoa6 TGC TGCGC 2: 155,250,211 (GRCm39) probably null Het
Npepl1 C T 2: 173,957,879 (GRCm39) P239S probably damaging Het
Olfml1 A G 7: 107,170,506 (GRCm39) K131R probably benign Het
Or12k5 G A 2: 36,895,462 (GRCm39) L55F probably damaging Het
Or1e29 A G 11: 73,667,935 (GRCm39) F73L possibly damaging Het
Or1j15 T A 2: 36,458,893 (GRCm39) Y94* probably null Het
Or1j20 T C 2: 36,760,022 (GRCm39) L148S possibly damaging Het
Or4c10 T A 2: 89,760,423 (GRCm39) I90K possibly damaging Het
Or4f7 A C 2: 111,644,213 (GRCm39) I286S probably damaging Het
Or5p52 C T 7: 107,502,212 (GRCm39) T96I probably benign Het
Or6c202 C T 10: 128,996,707 (GRCm39) D49N possibly damaging Het
Pde7a T C 3: 19,295,697 (GRCm39) probably benign Het
Pik3c2g T C 6: 139,903,519 (GRCm39) C591R probably benign Het
Pkn2 T G 3: 142,559,343 (GRCm39) K61Q probably damaging Het
Ppfia1 C A 7: 144,058,711 (GRCm39) G722C probably damaging Het
Ppp1cb T C 5: 32,644,958 (GRCm39) V263A probably damaging Het
Rab11fip2 A T 19: 59,895,567 (GRCm39) N440K possibly damaging Het
Rbm34 T A 8: 127,676,234 (GRCm39) K340N probably damaging Het
Samd3 T C 10: 26,147,399 (GRCm39) probably benign Het
Sfi1 TCGC TC 11: 3,096,254 (GRCm39) probably null Het
Sigirr T C 7: 140,671,285 (GRCm39) D399G probably damaging Het
Slc17a7 A G 7: 44,824,371 (GRCm39) E554G probably benign Het
Smc3 A G 19: 53,589,993 (GRCm39) probably benign Het
Tdrd1 T C 19: 56,819,703 (GRCm39) Y68H probably benign Het
Tespa1 T A 10: 130,196,719 (GRCm39) L219Q probably damaging Het
Tmem144 G A 3: 79,746,580 (GRCm39) probably benign Het
Ttc38 A G 15: 85,740,673 (GRCm39) S436G probably benign Het
Ttn T A 2: 76,581,423 (GRCm39) I23157F probably damaging Het
Ubxn2b T A 4: 6,203,875 (GRCm39) probably benign Het
Vmn1r28 G A 6: 58,242,702 (GRCm39) A182T probably benign Het
Vmn2r72 T C 7: 85,401,044 (GRCm39) E125G probably benign Het
Vmn2r78 A T 7: 86,572,235 (GRCm39) D532V probably benign Het
Vwa8 C A 14: 79,320,222 (GRCm39) L1078I probably benign Het
Vwce A T 19: 10,641,453 (GRCm39) probably null Het
Zpr1 A G 9: 46,190,995 (GRCm39) D300G probably damaging Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79,286,731 (GRCm39) missense probably damaging 0.99
IGL00801:Nf1 APN 11 79,319,526 (GRCm39) splice site probably benign
IGL00823:Nf1 APN 11 79,456,343 (GRCm39) missense probably damaging 1.00
IGL00945:Nf1 APN 11 79,360,629 (GRCm39) missense probably damaging 0.99
IGL00960:Nf1 APN 11 79,335,947 (GRCm39) missense probably damaging 1.00
IGL01118:Nf1 APN 11 79,437,812 (GRCm39) missense probably damaging 0.99
IGL01604:Nf1 APN 11 79,332,535 (GRCm39) splice site probably benign
IGL01637:Nf1 APN 11 79,437,946 (GRCm39) missense probably damaging 1.00
IGL01659:Nf1 APN 11 79,450,275 (GRCm39) missense probably benign
IGL01764:Nf1 APN 11 79,275,013 (GRCm39) missense probably benign
IGL01772:Nf1 APN 11 79,281,075 (GRCm39) missense probably damaging 1.00
IGL02047:Nf1 APN 11 79,316,361 (GRCm39) missense probably benign 0.04
IGL02052:Nf1 APN 11 79,303,553 (GRCm39) missense probably damaging 1.00
IGL02071:Nf1 APN 11 79,334,947 (GRCm39) missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79,335,474 (GRCm39) missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79,455,752 (GRCm39) missense probably benign 0.33
IGL02390:Nf1 APN 11 79,456,761 (GRCm39) missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79,302,502 (GRCm39) splice site probably benign
IGL02475:Nf1 APN 11 79,426,493 (GRCm39) missense probably damaging 1.00
IGL02567:Nf1 APN 11 79,437,969 (GRCm39) missense probably damaging 1.00
IGL02571:Nf1 APN 11 79,319,453 (GRCm39) missense probably damaging 1.00
IGL02664:Nf1 APN 11 79,335,424 (GRCm39) critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79,335,425 (GRCm39) critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79,325,759 (GRCm39) splice site probably benign
IGL03006:Nf1 APN 11 79,436,257 (GRCm39) missense probably damaging 1.00
IGL03216:Nf1 APN 11 79,455,721 (GRCm39) missense probably benign 0.17
Diesel UTSW 11 79,447,549 (GRCm39) missense probably damaging 0.96
Eyecandy UTSW 11 79,436,291 (GRCm39) missense probably damaging 1.00
Franklin UTSW 11 79,364,146 (GRCm39) splice site probably null
Gasoline UTSW 11 79,447,615 (GRCm39) missense probably benign 0.17
hancock UTSW 11 79,427,676 (GRCm39) missense probably benign
independence UTSW 11 79,345,136 (GRCm39) intron probably benign
jackson UTSW 11 79,338,398 (GRCm39) missense probably damaging 1.00
Jefferson UTSW 11 79,337,690 (GRCm39) missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79,345,015 (GRCm39) missense probably damaging 1.00
responsibility UTSW 11 79,456,801 (GRCm39) missense probably damaging 0.99
weepy UTSW 11 79,437,812 (GRCm39) missense probably damaging 1.00
C9142:Nf1 UTSW 11 79,447,557 (GRCm39) missense probably damaging 0.98
I2289:Nf1 UTSW 11 79,438,602 (GRCm39) missense probably damaging 1.00
R0055:Nf1 UTSW 11 79,362,377 (GRCm39) missense probably damaging 1.00
R0055:Nf1 UTSW 11 79,362,377 (GRCm39) missense probably damaging 1.00
R0115:Nf1 UTSW 11 79,359,702 (GRCm39) critical splice donor site probably null
R0144:Nf1 UTSW 11 79,437,953 (GRCm39) missense probably damaging 1.00
R0196:Nf1 UTSW 11 79,469,098 (GRCm39) missense probably damaging 1.00
R0196:Nf1 UTSW 11 79,359,595 (GRCm39) missense possibly damaging 0.94
R0217:Nf1 UTSW 11 79,319,400 (GRCm39) splice site probably benign
R0238:Nf1 UTSW 11 79,309,400 (GRCm39) missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79,309,400 (GRCm39) missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79,309,400 (GRCm39) missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79,309,400 (GRCm39) missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79,299,525 (GRCm39) splice site probably null
R0362:Nf1 UTSW 11 79,427,704 (GRCm39) missense probably damaging 1.00
R0364:Nf1 UTSW 11 79,332,783 (GRCm39) nonsense probably null
R0464:Nf1 UTSW 11 79,447,615 (GRCm39) missense probably benign 0.17
R0511:Nf1 UTSW 11 79,329,595 (GRCm39) missense probably benign 0.01
R0549:Nf1 UTSW 11 79,359,597 (GRCm39) missense probably damaging 0.99
R0585:Nf1 UTSW 11 79,459,527 (GRCm39) missense probably damaging 0.99
R0636:Nf1 UTSW 11 79,426,529 (GRCm39) missense probably damaging 0.99
R0924:Nf1 UTSW 11 79,344,692 (GRCm39) missense probably damaging 0.98
R0942:Nf1 UTSW 11 79,329,537 (GRCm39) missense probably benign 0.00
R1022:Nf1 UTSW 11 79,437,859 (GRCm39) missense probably damaging 1.00
R1024:Nf1 UTSW 11 79,437,859 (GRCm39) missense probably damaging 1.00
R1350:Nf1 UTSW 11 79,303,513 (GRCm39) missense probably damaging 1.00
R1365:Nf1 UTSW 11 79,438,711 (GRCm39) splice site probably null
R1395:Nf1 UTSW 11 79,426,809 (GRCm39) missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79,319,452 (GRCm39) missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79,319,452 (GRCm39) missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79,286,685 (GRCm39) nonsense probably null
R1508:Nf1 UTSW 11 79,331,735 (GRCm39) missense probably damaging 1.00
R1512:Nf1 UTSW 11 79,281,195 (GRCm39) missense probably damaging 1.00
R1605:Nf1 UTSW 11 79,331,749 (GRCm39) missense probably benign 0.01
R1680:Nf1 UTSW 11 79,441,824 (GRCm39) nonsense probably null
R1704:Nf1 UTSW 11 79,354,127 (GRCm39) splice site probably null
R1707:Nf1 UTSW 11 79,426,430 (GRCm39) missense probably damaging 1.00
R1741:Nf1 UTSW 11 79,334,757 (GRCm39) missense probably benign
R1761:Nf1 UTSW 11 79,275,091 (GRCm39) missense probably damaging 1.00
R1800:Nf1 UTSW 11 79,444,794 (GRCm39) missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79,437,987 (GRCm39) missense probably damaging 1.00
R1966:Nf1 UTSW 11 79,302,390 (GRCm39) missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79,303,571 (GRCm39) missense probably damaging 0.96
R1970:Nf1 UTSW 11 79,444,787 (GRCm39) missense probably benign 0.08
R2059:Nf1 UTSW 11 79,447,549 (GRCm39) missense probably damaging 0.96
R2105:Nf1 UTSW 11 79,360,652 (GRCm39) missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79,338,396 (GRCm39) missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79,334,890 (GRCm39) missense probably benign 0.39
R2497:Nf1 UTSW 11 79,334,710 (GRCm39) missense probably damaging 1.00
R2899:Nf1 UTSW 11 79,303,584 (GRCm39) missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79,437,812 (GRCm39) missense probably damaging 1.00
R3120:Nf1 UTSW 11 79,455,725 (GRCm39) missense probably damaging 0.99
R3744:Nf1 UTSW 11 79,439,573 (GRCm39) missense probably benign 0.23
R3801:Nf1 UTSW 11 79,450,347 (GRCm39) missense probably null 0.98
R3804:Nf1 UTSW 11 79,450,347 (GRCm39) missense probably null 0.98
R4212:Nf1 UTSW 11 79,360,624 (GRCm39) missense probably damaging 1.00
R4298:Nf1 UTSW 11 79,275,070 (GRCm39) missense probably damaging 1.00
R4578:Nf1 UTSW 11 79,336,585 (GRCm39) missense probably damaging 1.00
R4579:Nf1 UTSW 11 79,359,583 (GRCm39) missense probably damaging 1.00
R4587:Nf1 UTSW 11 79,426,863 (GRCm39) critical splice donor site probably null
R4793:Nf1 UTSW 11 79,338,398 (GRCm39) missense probably damaging 1.00
R4834:Nf1 UTSW 11 79,437,123 (GRCm39) missense probably damaging 1.00
R4863:Nf1 UTSW 11 79,300,235 (GRCm39) missense probably damaging 1.00
R4967:Nf1 UTSW 11 79,456,379 (GRCm39) critical splice donor site probably null
R4971:Nf1 UTSW 11 79,335,469 (GRCm39) missense probably damaging 1.00
R5034:Nf1 UTSW 11 79,334,976 (GRCm39) missense probably damaging 0.98
R5036:Nf1 UTSW 11 79,337,690 (GRCm39) missense probably damaging 1.00
R5207:Nf1 UTSW 11 79,345,015 (GRCm39) missense probably damaging 1.00
R5348:Nf1 UTSW 11 79,455,725 (GRCm39) missense probably damaging 1.00
R5356:Nf1 UTSW 11 79,364,282 (GRCm39) missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79,334,785 (GRCm39) missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79,336,615 (GRCm39) missense probably damaging 0.99
R5918:Nf1 UTSW 11 79,460,048 (GRCm39) intron probably benign
R5978:Nf1 UTSW 11 79,431,245 (GRCm39) missense probably damaging 1.00
R6140:Nf1 UTSW 11 79,364,146 (GRCm39) splice site probably null
R6195:Nf1 UTSW 11 79,456,801 (GRCm39) missense probably damaging 0.99
R6216:Nf1 UTSW 11 79,302,433 (GRCm39) missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79,456,801 (GRCm39) missense probably damaging 0.99
R6257:Nf1 UTSW 11 79,440,317 (GRCm39) missense probably damaging 1.00
R6258:Nf1 UTSW 11 79,456,581 (GRCm39) splice site probably null
R6756:Nf1 UTSW 11 79,335,413 (GRCm39) splice site probably null
R6878:Nf1 UTSW 11 79,325,708 (GRCm39) missense probably damaging 1.00
R6959:Nf1 UTSW 11 79,440,294 (GRCm39) missense probably damaging 0.98
R7007:Nf1 UTSW 11 79,337,849 (GRCm39) splice site probably null
R7066:Nf1 UTSW 11 79,447,546 (GRCm39) missense probably damaging 1.00
R7099:Nf1 UTSW 11 79,461,156 (GRCm39) missense probably benign 0.08
R7213:Nf1 UTSW 11 79,360,645 (GRCm39) missense probably benign 0.23
R7326:Nf1 UTSW 11 79,455,769 (GRCm39) missense probably benign
R7348:Nf1 UTSW 11 79,427,676 (GRCm39) missense probably benign
R7380:Nf1 UTSW 11 79,437,102 (GRCm39) missense probably damaging 1.00
R7407:Nf1 UTSW 11 79,338,969 (GRCm39) missense probably damaging 1.00
R7412:Nf1 UTSW 11 79,364,240 (GRCm39) missense probably damaging 1.00
R7545:Nf1 UTSW 11 79,300,350 (GRCm39) missense probably benign
R7567:Nf1 UTSW 11 79,438,052 (GRCm39) missense probably damaging 0.99
R7574:Nf1 UTSW 11 79,299,595 (GRCm39) missense probably null 0.99
R7616:Nf1 UTSW 11 79,275,092 (GRCm39) missense probably damaging 0.97
R7713:Nf1 UTSW 11 79,316,432 (GRCm39) missense probably benign
R7737:Nf1 UTSW 11 79,436,314 (GRCm39) missense probably benign 0.33
R7869:Nf1 UTSW 11 79,309,414 (GRCm39) missense probably damaging 1.00
R7905:Nf1 UTSW 11 79,437,938 (GRCm39) missense possibly damaging 0.80
R8232:Nf1 UTSW 11 79,469,157 (GRCm39) missense probably damaging 0.96
R8244:Nf1 UTSW 11 79,331,750 (GRCm39) missense probably benign
R8397:Nf1 UTSW 11 79,438,518 (GRCm39) missense probably damaging 1.00
R8436:Nf1 UTSW 11 79,349,709 (GRCm39) missense probably damaging 0.99
R8492:Nf1 UTSW 11 79,299,248 (GRCm39) missense probably benign 0.06
R8719:Nf1 UTSW 11 79,281,119 (GRCm39) missense possibly damaging 0.86
R8735:Nf1 UTSW 11 79,345,136 (GRCm39) intron probably benign
R8795:Nf1 UTSW 11 79,316,442 (GRCm39) missense probably damaging 1.00
R8797:Nf1 UTSW 11 79,366,711 (GRCm39) critical splice donor site probably benign
R8809:Nf1 UTSW 11 79,437,964 (GRCm39) missense probably damaging 0.99
R8812:Nf1 UTSW 11 79,437,180 (GRCm39) missense probably damaging 0.96
R8815:Nf1 UTSW 11 79,332,491 (GRCm39) missense probably damaging 1.00
R8828:Nf1 UTSW 11 79,286,679 (GRCm39) critical splice acceptor site probably null
R8894:Nf1 UTSW 11 79,336,619 (GRCm39) missense probably damaging 1.00
R9051:Nf1 UTSW 11 79,364,168 (GRCm39) missense probably damaging 1.00
R9103:Nf1 UTSW 11 79,450,332 (GRCm39) missense probably damaging 0.99
R9142:Nf1 UTSW 11 79,366,688 (GRCm39) missense probably damaging 1.00
R9142:Nf1 UTSW 11 79,362,315 (GRCm39) missense probably damaging 1.00
R9170:Nf1 UTSW 11 79,436,291 (GRCm39) missense probably damaging 1.00
R9201:Nf1 UTSW 11 79,461,156 (GRCm39) missense probably benign 0.08
R9267:Nf1 UTSW 11 79,331,716 (GRCm39) missense possibly damaging 0.72
R9309:Nf1 UTSW 11 79,359,595 (GRCm39) missense possibly damaging 0.94
R9340:Nf1 UTSW 11 79,447,629 (GRCm39) missense possibly damaging 0.90
R9398:Nf1 UTSW 11 79,438,018 (GRCm39) missense probably damaging 0.99
R9471:Nf1 UTSW 11 79,436,195 (GRCm39) missense probably damaging 0.99
R9630:Nf1 UTSW 11 79,302,470 (GRCm39) missense probably damaging 1.00
R9664:Nf1 UTSW 11 79,334,733 (GRCm39) missense probably damaging 1.00
X0052:Nf1 UTSW 11 79,450,242 (GRCm39) missense probably damaging 0.99
Z1177:Nf1 UTSW 11 79,455,751 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCTTGCCTTCTGGTAAAGCC -3'
(R):5'- GCCAATCCGAAGATGTGATGATGACTC -3'

Sequencing Primer
(F):5'- GCCTTCTGGTAAAGCCTTAAATC -3'
(R):5'- TGACTCGTAATAAAGGGTCCAAG -3'
Posted On 2013-04-11