Incidental Mutation 'R1774:Cyp11a1'
ID196937
Institutional Source Beutler Lab
Gene Symbol Cyp11a1
Ensembl Gene ENSMUSG00000032323
Gene Namecytochrome P450, family 11, subfamily a, polypeptide 1
SynonymsCyp11a, cholesterol side chain cleavage, Scc, cscc, D9Ertd411e, P450scc
MMRRC Submission 039805-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1774 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location58006411-58027023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58018360 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 93 (I93F)
Ref Sequence ENSEMBL: ENSMUSP00000140777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034874] [ENSMUST00000188116] [ENSMUST00000188539]
Predicted Effect probably benign
Transcript: ENSMUST00000034874
AA Change: I195F

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000034874
Gene: ENSMUSG00000032323
AA Change: I195F

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
Pfam:p450 49 507 1.8e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188116
SMART Domains Protein: ENSMUSP00000140545
Gene: ENSMUSG00000032323

DomainStartEndE-ValueType
Pfam:p450 32 115 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188539
AA Change: I93F

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140777
Gene: ENSMUSG00000032323
AA Change: I93F

DomainStartEndE-ValueType
Pfam:p450 23 279 2.6e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188944
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and catalyzes the conversion of cholesterol to pregnenolone, the first and rate-limiting step in the synthesis of the steroid hormones. Two transcript variants encoding different isoforms have been found for this gene. The cellular location of the smaller isoform is unclear since it lacks the mitochondrial-targeting transit peptide. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are exhibit a steroid deficiency and die within days of birth showing signs of dehydration. Males are feminized with female external genitalia and underdeveloped gonads. Mice homozgyous for another knock-out allele exhibit abnormal adrenal development and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,045,541 V312A probably damaging Het
2810408A11Rik A G 11: 69,900,627 V42A probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Angpt1 T A 15: 42,523,616 Q114L probably damaging Het
Apc2 T C 10: 80,309,130 I625T probably damaging Het
Atg2a T C 19: 6,250,598 V735A probably benign Het
Birc6 T A 17: 74,640,013 I2909N probably damaging Het
C7 C G 15: 5,012,075 D450H probably damaging Het
Cachd1 C T 4: 100,964,435 T403I probably damaging Het
Cachd1 T A 4: 100,967,043 F560L probably benign Het
Cacna2d2 A T 9: 107,526,151 Y944F probably benign Het
Cdkal1 C T 13: 29,850,048 D21N probably damaging Het
Col18a1 T C 10: 77,059,981 R901G probably damaging Het
Col27a1 C T 4: 63,225,713 P546L probably damaging Het
Cps1 C T 1: 67,170,882 R624W possibly damaging Het
Cyp2c40 G C 19: 39,786,806 T334R probably damaging Het
Cyp4f37 A G 17: 32,629,890 D244G possibly damaging Het
D630003M21Rik A T 2: 158,220,470 D43E probably damaging Het
Ep400 C A 5: 110,685,491 C1955F unknown Het
Ethe1 G A 7: 24,593,946 V6I probably benign Het
F5 C A 1: 164,192,535 Q860K probably benign Het
Fasn T C 11: 120,817,171 Y685C probably damaging Het
Gga2 T G 7: 122,012,221 D38A probably damaging Het
Gm12794 G A 4: 101,940,458 V18M probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm43302 T A 5: 105,275,794 I438F probably benign Het
Grm1 T A 10: 11,079,866 T225S possibly damaging Het
Hic2 G T 16: 17,258,647 V447L probably damaging Het
Hsf2 G A 10: 57,512,146 C462Y probably damaging Het
Ice1 T C 13: 70,604,553 D1138G probably damaging Het
Il6 A G 5: 30,019,435 T158A probably benign Het
Inpp5d T A 1: 87,667,889 V120E probably benign Het
Iqca T C 1: 90,080,903 N456S probably benign Het
Itgal T A 7: 127,309,622 probably null Het
Lrrc66 G C 5: 73,610,855 Q248E probably benign Het
Lrrc7 T A 3: 158,160,292 M1271L possibly damaging Het
Lrrc74a T C 12: 86,749,053 S267P probably damaging Het
Map2 T C 1: 66,414,074 S550P probably damaging Het
Mapk8ip3 A T 17: 24,924,145 probably null Het
Mdm4 A C 1: 132,996,646 S246A probably damaging Het
Med23 A G 10: 24,903,686 E887G probably damaging Het
Mgea5 T C 19: 45,776,984 E128G probably benign Het
Mta1 C T 12: 113,128,039 A254V probably damaging Het
Myh2 A G 11: 67,173,474 Y85C possibly damaging Het
Myo1g A G 11: 6,515,988 Y366H probably damaging Het
Nalcn G A 14: 123,278,266 P1708S probably benign Het
Nlrp9c A T 7: 26,394,118 S41T probably benign Het
Nptx2 T A 5: 144,553,438 S226T possibly damaging Het
Nup85 T A 11: 115,582,945 S562T probably benign Het
Nxpe5 T C 5: 138,239,535 V107A probably benign Het
Olfr129 A G 17: 38,055,437 V43A probably benign Het
Olfr273 T A 4: 52,855,674 I280F probably benign Het
Olfr414 A G 1: 174,431,339 T304A probably benign Het
Olfr455 A T 6: 42,538,519 F168I probably damaging Het
Pcdhb12 C T 18: 37,436,442 P214S possibly damaging Het
Pcdhb5 T A 18: 37,322,672 F702I probably damaging Het
Pcnx T C 12: 81,975,320 F1475S probably damaging Het
Pde5a C A 3: 122,729,364 T40N probably benign Het
Pnpla2 T A 7: 141,459,568 V398E probably damaging Het
Rab20 T C 8: 11,454,223 K159R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rgs12 T A 5: 34,966,403 V510D probably benign Het
Rnf219 A G 14: 104,479,662 V425A possibly damaging Het
Slamf6 T C 1: 171,942,587 probably benign Het
Slc27a5 A T 7: 12,997,607 C23* probably null Het
Slc35e2 T C 4: 155,610,164 V56A possibly damaging Het
Slx4ip T C 2: 137,067,723 S143P probably damaging Het
Stat5a C T 11: 100,879,286 S463F probably damaging Het
Svep1 T C 4: 58,146,562 D360G possibly damaging Het
Tas2r143 A T 6: 42,400,371 D45V probably damaging Het
Tdrd5 G T 1: 156,277,509 R516S probably damaging Het
Thy1 A G 9: 44,047,339 D126G probably benign Het
Tspear C T 10: 77,873,185 T415I probably benign Het
Ttll5 C A 12: 85,933,402 T920K probably benign Het
Umod T C 7: 119,477,351 E64G possibly damaging Het
Usf3 A G 16: 44,215,670 N171S probably damaging Het
Vmn1r23 T A 6: 57,926,690 R34S probably damaging Het
Wasf1 C G 10: 40,934,479 P239R possibly damaging Het
Wdr95 C T 5: 149,564,392 R164* probably null Het
Zan C A 5: 137,419,989 C2949F unknown Het
Zbed4 T C 15: 88,780,877 S383P probably benign Het
Zcchc11 T C 4: 108,507,955 F542L probably damaging Het
Zfand5 T A 19: 21,276,531 C33S probably damaging Het
Zfp12 A G 5: 143,245,229 Y437C probably damaging Het
Zfp451 A C 1: 33,813,768 S22A probably benign Het
Other mutations in Cyp11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Cyp11a1 APN 9 58019313 missense probably damaging 1.00
IGL01122:Cyp11a1 APN 9 58016306 missense probably damaging 1.00
IGL01993:Cyp11a1 APN 9 58020823 missense probably damaging 1.00
PIT4431001:Cyp11a1 UTSW 9 58016272 critical splice acceptor site probably null
R0347:Cyp11a1 UTSW 9 58016260 unclassified probably benign
R1446:Cyp11a1 UTSW 9 58015277 missense possibly damaging 0.95
R1918:Cyp11a1 UTSW 9 58026757 missense probably damaging 1.00
R2935:Cyp11a1 UTSW 9 58016390 missense probably damaging 1.00
R3724:Cyp11a1 UTSW 9 58019322 missense probably benign 0.00
R4866:Cyp11a1 UTSW 9 58026097 missense probably damaging 1.00
R5301:Cyp11a1 UTSW 9 58019261 intron probably benign
R5718:Cyp11a1 UTSW 9 58018225 missense probably benign 0.00
R5787:Cyp11a1 UTSW 9 58015267 missense probably benign 0.03
R5988:Cyp11a1 UTSW 9 58020834 missense probably benign 0.01
R6044:Cyp11a1 UTSW 9 58026704 missense probably damaging 1.00
R6286:Cyp11a1 UTSW 9 58017418 intron probably benign
R6306:Cyp11a1 UTSW 9 58025100 missense probably benign 0.00
R6325:Cyp11a1 UTSW 9 58025568 missense probably benign
R6826:Cyp11a1 UTSW 9 58025087 missense probably damaging 0.97
R6931:Cyp11a1 UTSW 9 58025120 missense possibly damaging 0.77
R6960:Cyp11a1 UTSW 9 58018376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGGAAGAAAGACCGAATCGTC -3'
(R):5'- CTAAGTGTCCTTCAACAGTCAGCCC -3'

Sequencing Primer
(F):5'- TCGTCCTAAACCAAGAGGTG -3'
(R):5'- cagtcagcccagatcaacc -3'
Posted On2014-05-23