Incidental Mutation 'R0081:Ddx41'
ID19695
Institutional Source Beutler Lab
Gene Symbol Ddx41
Ensembl Gene ENSMUSG00000021494
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Synonyms2900024F02Rik
MMRRC Submission 038368-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0081 (G1)
Quality Score154
Status Validated
Chromosome13
Chromosomal Location55530410-55536658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55535380 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 171 (H171Q)
Ref Sequence ENSEMBL: ENSMUSP00000153348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021956] [ENSMUST00000021957] [ENSMUST00000224765]
Predicted Effect probably benign
Transcript: ENSMUST00000021956
AA Change: H160Q

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021956
Gene: ENSMUSG00000021494
AA Change: H160Q

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 39 56 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
DEXDc 200 411 8.56e-53 SMART
HELICc 446 527 5.99e-34 SMART
ZnF_C2HC 581 597 1.98e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021957
SMART Domains Protein: ENSMUSP00000021957
Gene: ENSMUSG00000021495

DomainStartEndE-ValueType
low complexity region 55 71 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
low complexity region 161 174 N/A INTRINSIC
low complexity region 198 242 N/A INTRINSIC
low complexity region 260 286 N/A INTRINSIC
coiled coil region 371 404 N/A INTRINSIC
low complexity region 566 573 N/A INTRINSIC
low complexity region 622 635 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Pfam:FAM193_C 722 776 9.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224686
Predicted Effect possibly damaging
Transcript: ENSMUST00000224765
AA Change: H171Q

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225783
Meta Mutation Damage Score 0.0894 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.2%
  • 10x: 88.5%
  • 20x: 63.6%
Validation Efficiency 94% (159/169)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD box protein family and interacts with several spliceosomal proteins. In addition, the encoded protein may recognize the bacterial second messengers cyclic di-GMP and cyclic di-AMP, resulting in the induction of genes involved in the innate immune response. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T C 8: 24,781,687 D485G probably damaging Het
Adamts19 T C 18: 58,903,065 probably null Het
Adgrd1 A T 5: 129,178,082 I598F probably damaging Het
Adh5 A G 3: 138,451,413 D245G probably benign Het
Adra2b T C 2: 127,364,292 V238A probably benign Het
Ank1 G A 8: 23,116,242 V1188I possibly damaging Het
Asap1 C T 15: 64,099,564 G905D probably damaging Het
AW554918 T C 18: 25,344,902 V428A probably benign Het
Birc6 T A 17: 74,643,441 S3226T probably benign Het
Cdh17 A T 4: 11,785,280 probably benign Het
Cyfip2 A T 11: 46,253,998 Y676* probably null Het
Dcaf17 T A 2: 71,078,468 probably benign Het
Dclre1a A G 19: 56,542,707 F736L probably damaging Het
Dennd5b G T 6: 148,993,759 Q1258K probably benign Het
Dock10 T C 1: 80,606,578 D137G probably damaging Het
Dpyd G A 3: 118,944,255 V482I probably benign Het
Erich6 A T 3: 58,636,126 probably benign Het
Fam193b A G 13: 55,554,211 probably benign Het
Foxp2 T C 6: 15,405,644 probably benign Het
Frmd4a T C 2: 4,572,441 probably null Het
Gas2l2 A G 11: 83,422,867 S540P possibly damaging Het
Glis2 T C 16: 4,613,653 V348A probably benign Het
Gm14443 C A 2: 175,169,936 G239V probably damaging Het
Gpr158 T C 2: 21,826,717 V876A probably damaging Het
H1foo A G 6: 115,949,981 E273G probably benign Het
Hadh C T 3: 131,235,636 D245N probably damaging Het
Hk2 A T 6: 82,734,976 probably benign Het
Ice1 A T 13: 70,619,044 Y108* probably null Het
Il10ra T G 9: 45,255,949 M435L probably benign Het
Inpp5k GT G 11: 75,631,147 probably null Het
Kank4 G T 4: 98,778,330 P627T probably benign Het
Kif16b A G 2: 142,707,426 probably benign Het
Lipn A G 19: 34,076,976 I205V probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myh1 T C 11: 67,215,857 M1255T probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo1d T G 11: 80,557,523 K925N probably benign Het
Myoz1 T A 14: 20,649,554 M239L probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nf1 C A 11: 79,453,979 probably benign Het
Npepl1 C T 2: 174,116,086 P239S probably damaging Het
Olfml1 A G 7: 107,571,299 K131R probably benign Het
Olfr1258 T A 2: 89,930,079 I90K possibly damaging Het
Olfr1303 A C 2: 111,813,868 I286S probably damaging Het
Olfr344 T A 2: 36,568,881 Y94* probably null Het
Olfr352 T C 2: 36,870,010 L148S possibly damaging Het
Olfr358 G A 2: 37,005,450 L55F probably damaging Het
Olfr389 A G 11: 73,777,109 F73L possibly damaging Het
Olfr472 C T 7: 107,903,005 T96I probably benign Het
Olfr771 C T 10: 129,160,838 D49N possibly damaging Het
Pde7a T C 3: 19,241,533 probably benign Het
Pik3c2g T C 6: 139,957,793 C591R probably benign Het
Pkn2 T G 3: 142,853,582 K61Q probably damaging Het
Ppfia1 C A 7: 144,504,974 G722C probably damaging Het
Ppp1cb T C 5: 32,487,614 V263A probably damaging Het
Rab11fip2 A T 19: 59,907,135 N440K possibly damaging Het
Rbm34 T A 8: 126,949,484 K340N probably damaging Het
Samd3 T C 10: 26,271,501 probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sigirr T C 7: 141,091,372 D399G probably damaging Het
Slc17a7 A G 7: 45,174,947 E554G probably benign Het
Smc3 A G 19: 53,601,562 probably benign Het
Tdrd1 T C 19: 56,831,271 Y68H probably benign Het
Tespa1 T A 10: 130,360,850 L219Q probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Ttc38 A G 15: 85,856,472 S436G probably benign Het
Ttn T A 2: 76,751,079 I23157F probably damaging Het
Ubxn2b T A 4: 6,203,875 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r72 T C 7: 85,751,836 E125G probably benign Het
Vmn2r78 A T 7: 86,923,027 D532V probably benign Het
Vwa8 C A 14: 79,082,782 L1078I probably benign Het
Vwce A T 19: 10,664,089 probably null Het
Zpr1 A G 9: 46,279,697 D300G probably damaging Het
Other mutations in Ddx41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ddx41 APN 13 55531399 missense probably damaging 1.00
IGL00516:Ddx41 APN 13 55532467 missense probably damaging 0.96
IGL02383:Ddx41 APN 13 55532357 missense probably benign 0.04
R0097:Ddx41 UTSW 13 55535878 splice site probably benign
R0412:Ddx41 UTSW 13 55530608 missense probably damaging 0.99
R0597:Ddx41 UTSW 13 55533006 missense probably damaging 1.00
R0699:Ddx41 UTSW 13 55531299 splice site probably benign
R1330:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R1812:Ddx41 UTSW 13 55535954 missense probably benign 0.03
R2011:Ddx41 UTSW 13 55534093 splice site probably null
R2224:Ddx41 UTSW 13 55531401 missense probably damaging 1.00
R2310:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R2311:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R2355:Ddx41 UTSW 13 55534300 missense probably benign 0.03
R2983:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3032:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3764:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3773:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3916:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3926:Ddx41 UTSW 13 55531270 missense probably damaging 1.00
R4153:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4154:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4372:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4470:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4519:Ddx41 UTSW 13 55533144 missense probably damaging 1.00
R4569:Ddx41 UTSW 13 55536021 missense possibly damaging 0.88
R4823:Ddx41 UTSW 13 55532055 missense probably benign 0.02
R4837:Ddx41 UTSW 13 55531648 missense possibly damaging 0.95
R5443:Ddx41 UTSW 13 55535291 missense probably benign 0.00
R5642:Ddx41 UTSW 13 55535895 missense possibly damaging 0.86
R5926:Ddx41 UTSW 13 55534299 missense probably damaging 0.99
R5949:Ddx41 UTSW 13 55532061 missense probably damaging 1.00
R6035:Ddx41 UTSW 13 55533968 missense probably benign 0.00
R6035:Ddx41 UTSW 13 55533968 missense probably benign 0.00
R7254:Ddx41 UTSW 13 55533956 nonsense probably null
R7640:Ddx41 UTSW 13 55534239 missense possibly damaging 0.81
R7803:Ddx41 UTSW 13 55531921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTGGGATACACAACCTCACAG -3'
(R):5'- TGGTCTTGCTCATTGAGCCATGTC -3'

Sequencing Primer
(F):5'- CCTCACAGGGGCAAGATG -3'
(R):5'- GGCATCACCTATGACGATCC -3'
Posted On2013-04-11