Mutagenetix > Incidental Mutation

Incidental Mutation 'R1774:Pcnx'

196956

Institutional Source

Beutler Lab

Gene Symbol

Pcnx

Ensembl Gene

ENSMUSG00000021140

Gene Name

pecanex homolog

Synonyms

3526401J03Rik, 2900024E21Rik

MMRRC Submission

039805-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1774 (G1)

Quality Score

192

Status

Not validated

Chromosome

Chromosomal Location

81860023-82000924 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 81975320 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1475 (F1475S)

Ref Sequence

ENSEMBL: ENSMUSP00000021567 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]

AlphaFold

Q9QYC1

Predicted Effect

probably damaging
Transcript: ENSMUST00000021567
AA Change: F1475S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: F1475S

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
transmembrane domain	52	74	N/A	INTRINSIC
low complexity region	369	390	N/A	INTRINSIC
low complexity region	407	422	N/A	INTRINSIC
low complexity region	509	525	N/A	INTRINSIC
low complexity region	616	638	N/A	INTRINSIC
low complexity region	672	692	N/A	INTRINSIC
low complexity region	764	783	N/A	INTRINSIC
low complexity region	817	835	N/A	INTRINSIC
low complexity region	842	853	N/A	INTRINSIC
low complexity region	911	922	N/A	INTRINSIC
transmembrane domain	1006	1028	N/A	INTRINSIC
transmembrane domain	1035	1052	N/A	INTRINSIC
transmembrane domain	1070	1092	N/A	INTRINSIC
transmembrane domain	1113	1135	N/A	INTRINSIC
transmembrane domain	1163	1185	N/A	INTRINSIC
transmembrane domain	1197	1216	N/A	INTRINSIC
transmembrane domain	1269	1291	N/A	INTRINSIC
transmembrane domain	1298	1315	N/A	INTRINSIC
Pfam:Pecanex_C	1785	2011	1.6e-118	PFAM
low complexity region	2125	2140	N/A	INTRINSIC
low complexity region	2195	2202	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000221675
AA Change: F836S

Predicted Effect

probably damaging
Transcript: ENSMUST00000221721
AA Change: F1469S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000222005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222908

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	T	C	5: 145,045,541	V312A	probably damaging	Het
2810408A11Rik	A	G	11: 69,900,627	V42A	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Angpt1	T	A	15: 42,523,616	Q114L	probably damaging	Het
Apc2	T	C	10: 80,309,130	I625T	probably damaging	Het
Atg2a	T	C	19: 6,250,598	V735A	probably benign	Het
Birc6	T	A	17: 74,640,013	I2909N	probably damaging	Het
C7	C	G	15: 5,012,075	D450H	probably damaging	Het
Cachd1	C	T	4: 100,964,435	T403I	probably damaging	Het
Cachd1	T	A	4: 100,967,043	F560L	probably benign	Het
Cacna2d2	A	T	9: 107,526,151	Y944F	probably benign	Het
Cdkal1	C	T	13: 29,850,048	D21N	probably damaging	Het
Col18a1	T	C	10: 77,059,981	R901G	probably damaging	Het
Col27a1	C	T	4: 63,225,713	P546L	probably damaging	Het
Cps1	C	T	1: 67,170,882	R624W	possibly damaging	Het
Cyp11a1	A	T	9: 58,018,360	I93F	probably benign	Het
Cyp2c40	G	C	19: 39,786,806	T334R	probably damaging	Het
Cyp4f37	A	G	17: 32,629,890	D244G	possibly damaging	Het
D630003M21Rik	A	T	2: 158,220,470	D43E	probably damaging	Het
Ep400	C	A	5: 110,685,491	C1955F	unknown	Het
Ethe1	G	A	7: 24,593,946	V6I	probably benign	Het
F5	C	A	1: 164,192,535	Q860K	probably benign	Het
Fasn	T	C	11: 120,817,171	Y685C	probably damaging	Het
Gga2	T	G	7: 122,012,221	D38A	probably damaging	Het
Gm12794	G	A	4: 101,940,458	V18M	probably benign	Het
Gm14685	G	T	X: 73,127,655	G218C	probably damaging	Het
Gm43302	T	A	5: 105,275,794	I438F	probably benign	Het
Grm1	T	A	10: 11,079,866	T225S	possibly damaging	Het
Hic2	G	T	16: 17,258,647	V447L	probably damaging	Het
Hsf2	G	A	10: 57,512,146	C462Y	probably damaging	Het
Ice1	T	C	13: 70,604,553	D1138G	probably damaging	Het
Il6	A	G	5: 30,019,435	T158A	probably benign	Het
Inpp5d	T	A	1: 87,667,889	V120E	probably benign	Het
Iqca	T	C	1: 90,080,903	N456S	probably benign	Het
Itgal	T	A	7: 127,309,622		probably null	Het
Lrrc66	G	C	5: 73,610,855	Q248E	probably benign	Het
Lrrc7	T	A	3: 158,160,292	M1271L	possibly damaging	Het
Lrrc74a	T	C	12: 86,749,053	S267P	probably damaging	Het
Map2	T	C	1: 66,414,074	S550P	probably damaging	Het
Mapk8ip3	A	T	17: 24,924,145		probably null	Het
Mdm4	A	C	1: 132,996,646	S246A	probably damaging	Het
Med23	A	G	10: 24,903,686	E887G	probably damaging	Het
Mgea5	T	C	19: 45,776,984	E128G	probably benign	Het
Mta1	C	T	12: 113,128,039	A254V	probably damaging	Het
Myh2	A	G	11: 67,173,474	Y85C	possibly damaging	Het
Myo1g	A	G	11: 6,515,988	Y366H	probably damaging	Het
Nalcn	G	A	14: 123,278,266	P1708S	probably benign	Het
Nlrp9c	A	T	7: 26,394,118	S41T	probably benign	Het
Nptx2	T	A	5: 144,553,438	S226T	possibly damaging	Het
Nup85	T	A	11: 115,582,945	S562T	probably benign	Het
Nxpe5	T	C	5: 138,239,535	V107A	probably benign	Het
Olfr129	A	G	17: 38,055,437	V43A	probably benign	Het
Olfr273	T	A	4: 52,855,674	I280F	probably benign	Het
Olfr414	A	G	1: 174,431,339	T304A	probably benign	Het
Olfr455	A	T	6: 42,538,519	F168I	probably damaging	Het
Pcdhb12	C	T	18: 37,436,442	P214S	possibly damaging	Het
Pcdhb5	T	A	18: 37,322,672	F702I	probably damaging	Het
Pde5a	C	A	3: 122,729,364	T40N	probably benign	Het
Pnpla2	T	A	7: 141,459,568	V398E	probably damaging	Het
Rab20	T	C	8: 11,454,223	K159R	probably benign	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rgs12	T	A	5: 34,966,403	V510D	probably benign	Het
Rnf219	A	G	14: 104,479,662	V425A	possibly damaging	Het
Slamf6	T	C	1: 171,942,587		probably benign	Het
Slc27a5	A	T	7: 12,997,607	C23*	probably null	Het
Slc35e2	T	C	4: 155,610,164	V56A	possibly damaging	Het
Slx4ip	T	C	2: 137,067,723	S143P	probably damaging	Het
Stat5a	C	T	11: 100,879,286	S463F	probably damaging	Het
Svep1	T	C	4: 58,146,562	D360G	possibly damaging	Het
Tas2r143	A	T	6: 42,400,371	D45V	probably damaging	Het
Tdrd5	G	T	1: 156,277,509	R516S	probably damaging	Het
Thy1	A	G	9: 44,047,339	D126G	probably benign	Het
Tspear	C	T	10: 77,873,185	T415I	probably benign	Het
Ttll5	C	A	12: 85,933,402	T920K	probably benign	Het
Umod	T	C	7: 119,477,351	E64G	possibly damaging	Het
Usf3	A	G	16: 44,215,670	N171S	probably damaging	Het
Vmn1r23	T	A	6: 57,926,690	R34S	probably damaging	Het
Wasf1	C	G	10: 40,934,479	P239R	possibly damaging	Het
Wdr95	C	T	5: 149,564,392	R164*	probably null	Het
Zan	C	A	5: 137,419,989	C2949F	unknown	Het
Zbed4	T	C	15: 88,780,877	S383P	probably benign	Het
Zcchc11	T	C	4: 108,507,955	F542L	probably damaging	Het
Zfand5	T	A	19: 21,276,531	C33S	probably damaging	Het
Zfp12	A	G	5: 143,245,229	Y437C	probably damaging	Het
Zfp451	A	C	1: 33,813,768	S22A	probably benign	Het

Other mutations in Pcnx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Pcnx	APN	12	81895101	missense	probably damaging	0.98
IGL00561:Pcnx	APN	12	81996053	missense	probably damaging	1.00
IGL01066:Pcnx	APN	12	81992021	missense	possibly damaging	0.87
IGL01069:Pcnx	APN	12	81918144	missense	probably benign	0.27
IGL01082:Pcnx	APN	12	81990598	missense	possibly damaging	0.62
IGL01087:Pcnx	APN	12	81995339	splice site	probably benign
IGL01145:Pcnx	APN	12	81992035	missense	probably damaging	0.99
IGL01412:Pcnx	APN	12	81906465	missense	probably damaging	1.00
IGL01477:Pcnx	APN	12	81973241	missense	probably damaging	0.98
IGL01639:Pcnx	APN	12	81950320	critical splice donor site	probably null
IGL01815:Pcnx	APN	12	81990551	missense	probably damaging	1.00
IGL01870:Pcnx	APN	12	81975893	missense	probably benign	0.01
IGL01902:Pcnx	APN	12	81979094	missense	probably damaging	1.00
IGL01935:Pcnx	APN	12	81917816	missense	probably benign	0.00
IGL02141:Pcnx	APN	12	81860382	missense	possibly damaging	0.86
IGL02179:Pcnx	APN	12	81933719	intron	probably benign
IGL02197:Pcnx	APN	12	81919104	missense	probably benign	0.01
IGL02197:Pcnx	APN	12	81993151	missense	possibly damaging	0.85
IGL02238:Pcnx	APN	12	81917914	missense	probably damaging	1.00
IGL02430:Pcnx	APN	12	81919322	missense	possibly damaging	0.89
IGL02590:Pcnx	APN	12	81994978	missense	probably damaging	1.00
IGL02992:Pcnx	APN	12	81964120	missense	probably damaging	1.00
IGL03304:Pcnx	APN	12	81982029	missense	probably damaging	1.00
PIT4515001:Pcnx	UTSW	12	81991787	missense
R0086:Pcnx	UTSW	12	81992058	unclassified	probably benign
R0114:Pcnx	UTSW	12	81996095	missense	possibly damaging	0.95
R0240:Pcnx	UTSW	12	81947018	missense	possibly damaging	0.67
R0240:Pcnx	UTSW	12	81947018	missense	possibly damaging	0.67
R0376:Pcnx	UTSW	12	81974579	splice site	probably benign
R0377:Pcnx	UTSW	12	81974579	splice site	probably benign
R0416:Pcnx	UTSW	12	81974466	missense	probably benign	0.09
R0514:Pcnx	UTSW	12	81995110	missense	probably benign	0.21
R0563:Pcnx	UTSW	12	81917944	missense	probably damaging	1.00
R0569:Pcnx	UTSW	12	81992030	missense	probably benign	0.08
R0626:Pcnx	UTSW	12	81983676	missense	possibly damaging	0.82
R0972:Pcnx	UTSW	12	81913412	missense	probably damaging	1.00
R1205:Pcnx	UTSW	12	81956243	missense	probably damaging	1.00
R1455:Pcnx	UTSW	12	81973234	missense	probably damaging	1.00
R1514:Pcnx	UTSW	12	81918798	missense	probably damaging	1.00
R1731:Pcnx	UTSW	12	81990704	missense	probably damaging	1.00
R1758:Pcnx	UTSW	12	81983484	missense	probably benign	0.27
R1817:Pcnx	UTSW	12	81918642	missense	probably benign
R1843:Pcnx	UTSW	12	81980935	missense	probably damaging	1.00
R1862:Pcnx	UTSW	12	81918732	missense	probably damaging	1.00
R2042:Pcnx	UTSW	12	81918293	missense	probably damaging	1.00
R2054:Pcnx	UTSW	12	81933674	missense	probably benign	0.02
R2243:Pcnx	UTSW	12	81918705	missense	probably damaging	1.00
R2272:Pcnx	UTSW	12	81995314	missense	probably benign	0.26
R2360:Pcnx	UTSW	12	81950186	missense	probably damaging	0.99
R2926:Pcnx	UTSW	12	81994995	missense	probably damaging	1.00
R3607:Pcnx	UTSW	12	81928292	missense	probably damaging	1.00
R3781:Pcnx	UTSW	12	81996118	missense	probably benign	0.00
R3782:Pcnx	UTSW	12	81996118	missense	probably benign	0.00
R3806:Pcnx	UTSW	12	81950137	missense	possibly damaging	0.84
R3926:Pcnx	UTSW	12	81958731	missense	probably damaging	1.00
R4019:Pcnx	UTSW	12	81918244	missense	probably damaging	1.00
R4020:Pcnx	UTSW	12	81918244	missense	probably damaging	1.00
R4683:Pcnx	UTSW	12	81986672	missense	probably benign	0.01
R4703:Pcnx	UTSW	12	81895164	missense	probably benign	0.01
R4732:Pcnx	UTSW	12	81995751	missense	probably benign	0.01
R4733:Pcnx	UTSW	12	81995751	missense	probably benign	0.01
R4755:Pcnx	UTSW	12	81950294	missense	probably damaging	1.00
R4792:Pcnx	UTSW	12	81919151	missense	probably damaging	1.00
R4897:Pcnx	UTSW	12	81918165	missense	probably damaging	1.00
R4915:Pcnx	UTSW	12	81974495	missense	probably benign	0.10
R4934:Pcnx	UTSW	12	81991825	missense	possibly damaging	0.76
R4940:Pcnx	UTSW	12	81917793	missense	possibly damaging	0.60
R5079:Pcnx	UTSW	12	81979089	nonsense	probably null
R5087:Pcnx	UTSW	12	81994939	missense	probably damaging	1.00
R5284:Pcnx	UTSW	12	81919029	missense	probably benign	0.02
R5287:Pcnx	UTSW	12	81982051	missense	probably damaging	1.00
R5436:Pcnx	UTSW	12	81860406	missense	probably damaging	1.00
R5505:Pcnx	UTSW	12	81950153	missense	probably damaging	1.00
R5538:Pcnx	UTSW	12	81860409	missense	probably damaging	1.00
R5632:Pcnx	UTSW	12	81917730	missense	probably damaging	1.00
R5642:Pcnx	UTSW	12	81895029	missense	possibly damaging	0.45
R5841:Pcnx	UTSW	12	81918655	missense	possibly damaging	0.62
R6275:Pcnx	UTSW	12	81918607	missense	probably benign	0.34
R6508:Pcnx	UTSW	12	81912705	missense	probably damaging	0.98
R6532:Pcnx	UTSW	12	81980964	missense	probably damaging	1.00
R6634:Pcnx	UTSW	12	81917882	nonsense	probably null
R6753:Pcnx	UTSW	12	81964480	missense	probably damaging	1.00
R6776:Pcnx	UTSW	12	81962722	missense	possibly damaging	0.81
R6778:Pcnx	UTSW	12	81918871	missense	probably damaging	1.00
R6890:Pcnx	UTSW	12	81971376	missense	probably benign	0.09
R6894:Pcnx	UTSW	12	81987973	missense	probably damaging	1.00
R6927:Pcnx	UTSW	12	81917812	missense	probably benign	0.37
R7173:Pcnx	UTSW	12	81953003	splice site	probably null
R7196:Pcnx	UTSW	12	81995538	missense	possibly damaging	0.94
R7316:Pcnx	UTSW	12	81995549	missense	probably benign	0.16
R7559:Pcnx	UTSW	12	81993122	missense	unknown
R7635:Pcnx	UTSW	12	81919125	missense
R7669:Pcnx	UTSW	12	81990551	missense	probably damaging	1.00
R8021:Pcnx	UTSW	12	81918819	nonsense	probably null
R8049:Pcnx	UTSW	12	81918819	nonsense	probably null
R8078:Pcnx	UTSW	12	81975280	missense
R8093:Pcnx	UTSW	12	81918819	nonsense	probably null
R8104:Pcnx	UTSW	12	81983611	nonsense	probably null
R8108:Pcnx	UTSW	12	81918819	nonsense	probably null
R8109:Pcnx	UTSW	12	81918819	nonsense	probably null
R8131:Pcnx	UTSW	12	81918518	missense	possibly damaging	0.80
R8136:Pcnx	UTSW	12	81918006	missense	probably benign
R8153:Pcnx	UTSW	12	81918819	nonsense	probably null
R8156:Pcnx	UTSW	12	81918819	nonsense	probably null
R8202:Pcnx	UTSW	12	81895047	missense	probably benign	0.00
R8362:Pcnx	UTSW	12	81967056	missense
R8515:Pcnx	UTSW	12	81962716	missense	possibly damaging	0.83
R8803:Pcnx	UTSW	12	81993151	missense	possibly damaging	0.85
R8820:Pcnx	UTSW	12	81973248	missense
R8828:Pcnx	UTSW	12	81995823	missense	probably damaging	1.00
R8946:Pcnx	UTSW	12	81971384	missense	probably damaging	0.96
R8964:Pcnx	UTSW	12	81993038	missense
R9152:Pcnx	UTSW	12	81975815	missense
R9256:Pcnx	UTSW	12	81973273	missense
R9287:Pcnx	UTSW	12	81995549	missense	probably benign	0.07
R9289:Pcnx	UTSW	12	81982079	missense
R9414:Pcnx	UTSW	12	81918204	missense	probably damaging	1.00
R9445:Pcnx	UTSW	12	81918207	missense	probably damaging	0.98
R9595:Pcnx	UTSW	12	81918914	missense
R9600:Pcnx	UTSW	12	81983661	missense
R9620:Pcnx	UTSW	12	81950186	missense	probably damaging	0.99
RF024:Pcnx	UTSW	12	81917727	missense	probably damaging	0.98
Z1177:Pcnx	UTSW	12	81918202	missense	probably damaging	0.98
Z1177:Pcnx	UTSW	12	81918677	missense

Predicted Primers

PCR Primer
(F):5'- GCTGGCAGTAGCAGTAATGCTGTG -3'
(R):5'- AGAATAGGGCAACGGTCCTCCAAG -3'

Sequencing Primer
(F):5'- TGGGAAAATGACTTCAGTGCC -3'
(R):5'- AGCCTGAGAGGCTTTGC -3'

Posted On

2014-05-23