Incidental Mutation 'R1774:Ttll5'
ID196957
Institutional Source Beutler Lab
Gene Symbol Ttll5
Ensembl Gene ENSMUSG00000012609
Gene Nametubulin tyrosine ligase-like family, member 5
SynonymsSTAMP
MMRRC Submission 039805-MU
Accession Numbers

Genbank: NM_001081423

Is this an essential gene? Possibly non essential (E-score: 0.436) question?
Stock #R1774 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85824659-86061893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 85933402 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 920 (T920K)
Ref Sequence ENSEMBL: ENSMUSP00000039939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040179] [ENSMUST00000040273] [ENSMUST00000110224] [ENSMUST00000155448] [ENSMUST00000176695] [ENSMUST00000177114]
Predicted Effect probably benign
Transcript: ENSMUST00000040179
AA Change: T920K

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000048809
Gene: ENSMUSG00000012609
AA Change: T920K

DomainStartEndE-ValueType
Pfam:TTL 110 407 1.9e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040273
AA Change: T920K

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039939
Gene: ENSMUSG00000012609
AA Change: T920K

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110224
AA Change: T907K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105853
Gene: ENSMUSG00000012609
AA Change: T907K

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 543 562 N/A INTRINSIC
low complexity region 582 608 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 768 780 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155448
SMART Domains Protein: ENSMUSP00000134971
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
Pfam:TTL 110 407 6.4e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176460
Predicted Effect probably benign
Transcript: ENSMUST00000176695
SMART Domains Protein: ENSMUSP00000135852
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176937
Predicted Effect probably benign
Transcript: ENSMUST00000177114
SMART Domains Protein: ENSMUSP00000135395
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000177168
AA Change: T355K
SMART Domains Protein: ENSMUSP00000134874
Gene: ENSMUSG00000012609
AA Change: T355K

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 603 617 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000177525
AA Change: T49K
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubulin tyrosine ligase like protein family. This protein interacts with two glucocorticoid receptor coactivators, transcriptional intermediary factor 2 and steroid receptor coactivator 1. This protein may function as a coregulator of glucocorticoid receptor mediated gene induction and repression. This protein may also function as an alpha tubulin polyglutamylase.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility associated with abnormal sperm morphology and reduced tubulin polyglutamylation in the spermatozoa. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(3) Gene trapped(4)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,045,541 V312A probably damaging Het
2810408A11Rik A G 11: 69,900,627 V42A probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Angpt1 T A 15: 42,523,616 Q114L probably damaging Het
Apc2 T C 10: 80,309,130 I625T probably damaging Het
Atg2a T C 19: 6,250,598 V735A probably benign Het
Birc6 T A 17: 74,640,013 I2909N probably damaging Het
C7 C G 15: 5,012,075 D450H probably damaging Het
Cachd1 C T 4: 100,964,435 T403I probably damaging Het
Cachd1 T A 4: 100,967,043 F560L probably benign Het
Cacna2d2 A T 9: 107,526,151 Y944F probably benign Het
Cdkal1 C T 13: 29,850,048 D21N probably damaging Het
Col18a1 T C 10: 77,059,981 R901G probably damaging Het
Col27a1 C T 4: 63,225,713 P546L probably damaging Het
Cps1 C T 1: 67,170,882 R624W possibly damaging Het
Cyp11a1 A T 9: 58,018,360 I93F probably benign Het
Cyp2c40 G C 19: 39,786,806 T334R probably damaging Het
Cyp4f37 A G 17: 32,629,890 D244G possibly damaging Het
D630003M21Rik A T 2: 158,220,470 D43E probably damaging Het
Ep400 C A 5: 110,685,491 C1955F unknown Het
Ethe1 G A 7: 24,593,946 V6I probably benign Het
F5 C A 1: 164,192,535 Q860K probably benign Het
Fasn T C 11: 120,817,171 Y685C probably damaging Het
Gga2 T G 7: 122,012,221 D38A probably damaging Het
Gm12794 G A 4: 101,940,458 V18M probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm43302 T A 5: 105,275,794 I438F probably benign Het
Grm1 T A 10: 11,079,866 T225S possibly damaging Het
Hic2 G T 16: 17,258,647 V447L probably damaging Het
Hsf2 G A 10: 57,512,146 C462Y probably damaging Het
Ice1 T C 13: 70,604,553 D1138G probably damaging Het
Il6 A G 5: 30,019,435 T158A probably benign Het
Inpp5d T A 1: 87,667,889 V120E probably benign Het
Iqca T C 1: 90,080,903 N456S probably benign Het
Itgal T A 7: 127,309,622 probably null Het
Lrrc66 G C 5: 73,610,855 Q248E probably benign Het
Lrrc7 T A 3: 158,160,292 M1271L possibly damaging Het
Lrrc74a T C 12: 86,749,053 S267P probably damaging Het
Map2 T C 1: 66,414,074 S550P probably damaging Het
Mapk8ip3 A T 17: 24,924,145 probably null Het
Mdm4 A C 1: 132,996,646 S246A probably damaging Het
Med23 A G 10: 24,903,686 E887G probably damaging Het
Mgea5 T C 19: 45,776,984 E128G probably benign Het
Mta1 C T 12: 113,128,039 A254V probably damaging Het
Myh2 A G 11: 67,173,474 Y85C possibly damaging Het
Myo1g A G 11: 6,515,988 Y366H probably damaging Het
Nalcn G A 14: 123,278,266 P1708S probably benign Het
Nlrp9c A T 7: 26,394,118 S41T probably benign Het
Nptx2 T A 5: 144,553,438 S226T possibly damaging Het
Nup85 T A 11: 115,582,945 S562T probably benign Het
Nxpe5 T C 5: 138,239,535 V107A probably benign Het
Olfr129 A G 17: 38,055,437 V43A probably benign Het
Olfr273 T A 4: 52,855,674 I280F probably benign Het
Olfr414 A G 1: 174,431,339 T304A probably benign Het
Olfr455 A T 6: 42,538,519 F168I probably damaging Het
Pcdhb12 C T 18: 37,436,442 P214S possibly damaging Het
Pcdhb5 T A 18: 37,322,672 F702I probably damaging Het
Pcnx T C 12: 81,975,320 F1475S probably damaging Het
Pde5a C A 3: 122,729,364 T40N probably benign Het
Pnpla2 T A 7: 141,459,568 V398E probably damaging Het
Rab20 T C 8: 11,454,223 K159R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rgs12 T A 5: 34,966,403 V510D probably benign Het
Rnf219 A G 14: 104,479,662 V425A possibly damaging Het
Slamf6 T C 1: 171,942,587 probably benign Het
Slc27a5 A T 7: 12,997,607 C23* probably null Het
Slc35e2 T C 4: 155,610,164 V56A possibly damaging Het
Slx4ip T C 2: 137,067,723 S143P probably damaging Het
Stat5a C T 11: 100,879,286 S463F probably damaging Het
Svep1 T C 4: 58,146,562 D360G possibly damaging Het
Tas2r143 A T 6: 42,400,371 D45V probably damaging Het
Tdrd5 G T 1: 156,277,509 R516S probably damaging Het
Thy1 A G 9: 44,047,339 D126G probably benign Het
Tspear C T 10: 77,873,185 T415I probably benign Het
Umod T C 7: 119,477,351 E64G possibly damaging Het
Usf3 A G 16: 44,215,670 N171S probably damaging Het
Vmn1r23 T A 6: 57,926,690 R34S probably damaging Het
Wasf1 C G 10: 40,934,479 P239R possibly damaging Het
Wdr95 C T 5: 149,564,392 R164* probably null Het
Zan C A 5: 137,419,989 C2949F unknown Het
Zbed4 T C 15: 88,780,877 S383P probably benign Het
Zcchc11 T C 4: 108,507,955 F542L probably damaging Het
Zfand5 T A 19: 21,276,531 C33S probably damaging Het
Zfp12 A G 5: 143,245,229 Y437C probably damaging Het
Zfp451 A C 1: 33,813,768 S22A probably benign Het
Other mutations in Ttll5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Ttll5 APN 12 85843826 missense probably damaging 1.00
IGL00932:Ttll5 APN 12 85929907 missense probably damaging 1.00
IGL00964:Ttll5 APN 12 85849283 missense possibly damaging 0.78
IGL00978:Ttll5 APN 12 85933482 nonsense probably null
IGL00990:Ttll5 APN 12 85876589 missense probably damaging 1.00
IGL01726:Ttll5 APN 12 85918934 missense probably benign 0.30
IGL01797:Ttll5 APN 12 85956597 missense possibly damaging 0.54
IGL02008:Ttll5 APN 12 85933611 missense probably damaging 1.00
IGL02210:Ttll5 APN 12 85912545 intron probably benign
IGL02979:Ttll5 APN 12 85826582 missense probably damaging 1.00
IGL03079:Ttll5 APN 12 85876558 missense probably damaging 1.00
IGL03149:Ttll5 APN 12 85918984 missense probably damaging 0.98
G4846:Ttll5 UTSW 12 86024244 missense probably damaging 0.99
PIT4812001:Ttll5 UTSW 12 85926861 missense probably benign 0.12
R0045:Ttll5 UTSW 12 85879359 splice site probably benign
R0153:Ttll5 UTSW 12 85831966 missense probably damaging 1.00
R0282:Ttll5 UTSW 12 85996053 missense probably benign 0.12
R0318:Ttll5 UTSW 12 85876594 critical splice donor site probably null
R0465:Ttll5 UTSW 12 85933326 missense probably benign 0.42
R0540:Ttll5 UTSW 12 85933676 critical splice donor site probably null
R1086:Ttll5 UTSW 12 85891079 missense possibly damaging 0.66
R1467:Ttll5 UTSW 12 85918962 splice site probably null
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1505:Ttll5 UTSW 12 85879410 missense probably damaging 1.00
R1524:Ttll5 UTSW 12 85864568 nonsense probably null
R1540:Ttll5 UTSW 12 85892208 nonsense probably null
R1598:Ttll5 UTSW 12 85863598 missense probably damaging 0.98
R1649:Ttll5 UTSW 12 85923014 missense probably damaging 1.00
R2340:Ttll5 UTSW 12 85892148 missense probably benign 0.02
R4049:Ttll5 UTSW 12 86012799 missense probably benign 0.01
R4094:Ttll5 UTSW 12 85956602 nonsense probably null
R4095:Ttll5 UTSW 12 85956602 nonsense probably null
R4908:Ttll5 UTSW 12 85919174 missense probably benign 0.31
R5012:Ttll5 UTSW 12 85926844 missense possibly damaging 0.93
R5137:Ttll5 UTSW 12 85923045 missense possibly damaging 0.83
R5416:Ttll5 UTSW 12 86012828 missense possibly damaging 0.77
R5773:Ttll5 UTSW 12 85933555 frame shift probably null
R5774:Ttll5 UTSW 12 85933555 frame shift probably null
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6173:Ttll5 UTSW 12 85933377 missense probably damaging 0.99
R6343:Ttll5 UTSW 12 85956699 missense probably benign 0.00
R6449:Ttll5 UTSW 12 86024276 missense probably benign 0.00
R6750:Ttll5 UTSW 12 85956610 missense probably damaging 0.98
R6802:Ttll5 UTSW 12 85879386 missense probably damaging 1.00
R6825:Ttll5 UTSW 12 85883328 intron probably null
R6955:Ttll5 UTSW 12 85864579 missense possibly damaging 0.91
R7098:Ttll5 UTSW 12 85917673 critical splice acceptor site probably null
R7154:Ttll5 UTSW 12 85925764 missense probably damaging 0.98
R7215:Ttll5 UTSW 12 85933396 missense probably benign 0.02
R7339:Ttll5 UTSW 12 85857464 critical splice donor site probably null
R7520:Ttll5 UTSW 12 85899471 missense probably damaging 1.00
R7728:Ttll5 UTSW 12 85956632 missense probably benign 0.02
R7894:Ttll5 UTSW 12 85889174 missense probably damaging 1.00
R7977:Ttll5 UTSW 12 85889174 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCTCGACACGTTTTGAGCAC -3'
(R):5'- AGGCAGCCATCATTTTCTCACTCAC -3'

Sequencing Primer
(F):5'- CTTTTCCCAGAGGGTGAGGAAC -3'
(R):5'- CGAGACAGTTTCTGGCTATAGATATG -3'
Posted On2014-05-23