Incidental Mutation 'R1774:Ice1'
ID 196963
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
MMRRC Submission 039805-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.946) question?
Stock # R1774 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 70736808-70785958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70752672 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1138 (D1138G)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
AlphaFold E9Q286
Predicted Effect probably damaging
Transcript: ENSMUST00000043493
AA Change: D1138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: D1138G

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 144,982,351 (GRCm39) V312A probably damaging Het
2810408A11Rik A G 11: 69,791,453 (GRCm39) V42A probably damaging Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Angpt1 T A 15: 42,387,012 (GRCm39) Q114L probably damaging Het
Apc2 T C 10: 80,144,964 (GRCm39) I625T probably damaging Het
Atg2a T C 19: 6,300,628 (GRCm39) V735A probably benign Het
Birc6 T A 17: 74,947,008 (GRCm39) I2909N probably damaging Het
C7 C G 15: 5,041,557 (GRCm39) D450H probably damaging Het
Cachd1 C T 4: 100,821,632 (GRCm39) T403I probably damaging Het
Cachd1 T A 4: 100,824,240 (GRCm39) F560L probably benign Het
Cacna2d2 A T 9: 107,403,350 (GRCm39) Y944F probably benign Het
Cdkal1 C T 13: 30,034,031 (GRCm39) D21N probably damaging Het
Col18a1 T C 10: 76,895,815 (GRCm39) R901G probably damaging Het
Col27a1 C T 4: 63,143,950 (GRCm39) P546L probably damaging Het
Cps1 C T 1: 67,210,041 (GRCm39) R624W possibly damaging Het
Cyp11a1 A T 9: 57,925,643 (GRCm39) I93F probably benign Het
Cyp2c40 G C 19: 39,775,250 (GRCm39) T334R probably damaging Het
Cyp4f37 A G 17: 32,848,864 (GRCm39) D244G possibly damaging Het
D630003M21Rik A T 2: 158,062,390 (GRCm39) D43E probably damaging Het
Ep400 C A 5: 110,833,357 (GRCm39) C1955F unknown Het
Ethe1 G A 7: 24,293,371 (GRCm39) V6I probably benign Het
F5 C A 1: 164,020,104 (GRCm39) Q860K probably benign Het
Fasn T C 11: 120,707,997 (GRCm39) Y685C probably damaging Het
Gga2 T G 7: 121,611,444 (GRCm39) D38A probably damaging Het
Gm43302 T A 5: 105,423,660 (GRCm39) I438F probably benign Het
Grm1 T A 10: 10,955,610 (GRCm39) T225S possibly damaging Het
Hic2 G T 16: 17,076,511 (GRCm39) V447L probably damaging Het
Hsf2 G A 10: 57,388,242 (GRCm39) C462Y probably damaging Het
Il6 A G 5: 30,224,433 (GRCm39) T158A probably benign Het
Inpp5d T A 1: 87,595,611 (GRCm39) V120E probably benign Het
Iqca1 T C 1: 90,008,625 (GRCm39) N456S probably benign Het
Itgal T A 7: 126,908,794 (GRCm39) probably null Het
Lrrc66 G C 5: 73,768,198 (GRCm39) Q248E probably benign Het
Lrrc7 T A 3: 157,865,929 (GRCm39) M1271L possibly damaging Het
Lrrc74a T C 12: 86,795,827 (GRCm39) S267P probably damaging Het
Map2 T C 1: 66,453,233 (GRCm39) S550P probably damaging Het
Mapk8ip3 A T 17: 25,143,119 (GRCm39) probably null Het
Mdm4 A C 1: 132,924,384 (GRCm39) S246A probably damaging Het
Med23 A G 10: 24,779,584 (GRCm39) E887G probably damaging Het
Mta1 C T 12: 113,091,659 (GRCm39) A254V probably damaging Het
Myh2 A G 11: 67,064,300 (GRCm39) Y85C possibly damaging Het
Myo1g A G 11: 6,465,988 (GRCm39) Y366H probably damaging Het
Nalcn G A 14: 123,515,678 (GRCm39) P1708S probably benign Het
Nlrp9c A T 7: 26,093,543 (GRCm39) S41T probably benign Het
Nptx2 T A 5: 144,490,248 (GRCm39) S226T possibly damaging Het
Nup85 T A 11: 115,473,771 (GRCm39) S562T probably benign Het
Nxpe5 T C 5: 138,237,797 (GRCm39) V107A probably benign Het
Obi1 A G 14: 104,717,098 (GRCm39) V425A possibly damaging Het
Oga T C 19: 45,765,423 (GRCm39) E128G probably benign Het
Or10ac1 A T 6: 42,515,453 (GRCm39) F168I probably damaging Het
Or10al7 A G 17: 38,366,328 (GRCm39) V43A probably benign Het
Or13c3 T A 4: 52,855,674 (GRCm39) I280F probably benign Het
Or6p1 A G 1: 174,258,905 (GRCm39) T304A probably benign Het
Pcdhb12 C T 18: 37,569,495 (GRCm39) P214S possibly damaging Het
Pcdhb5 T A 18: 37,455,725 (GRCm39) F702I probably damaging Het
Pcnx1 T C 12: 82,022,094 (GRCm39) F1475S probably damaging Het
Pde5a C A 3: 122,523,013 (GRCm39) T40N probably benign Het
Pnpla2 T A 7: 141,039,481 (GRCm39) V398E probably damaging Het
Pramel19 G A 4: 101,797,655 (GRCm39) V18M probably benign Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Het
Rab20 T C 8: 11,504,223 (GRCm39) K159R probably benign Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Rgs12 T A 5: 35,123,747 (GRCm39) V510D probably benign Het
Slamf6 T C 1: 171,770,154 (GRCm39) probably benign Het
Slc27a5 A T 7: 12,731,534 (GRCm39) C23* probably null Het
Slc35e2 T C 4: 155,694,621 (GRCm39) V56A possibly damaging Het
Slx4ip T C 2: 136,909,643 (GRCm39) S143P probably damaging Het
Stat5a C T 11: 100,770,112 (GRCm39) S463F probably damaging Het
Svep1 T C 4: 58,146,562 (GRCm39) D360G possibly damaging Het
Tas2r143 A T 6: 42,377,305 (GRCm39) D45V probably damaging Het
Tdrd5 G T 1: 156,105,079 (GRCm39) R516S probably damaging Het
Thy1 A G 9: 43,958,636 (GRCm39) D126G probably benign Het
Tspear C T 10: 77,709,019 (GRCm39) T415I probably benign Het
Ttll5 C A 12: 85,980,176 (GRCm39) T920K probably benign Het
Tut4 T C 4: 108,365,152 (GRCm39) F542L probably damaging Het
Umod T C 7: 119,076,574 (GRCm39) E64G possibly damaging Het
Usf3 A G 16: 44,036,033 (GRCm39) N171S probably damaging Het
Vmn1r23 T A 6: 57,903,675 (GRCm39) R34S probably damaging Het
Wasf1 C G 10: 40,810,475 (GRCm39) P239R possibly damaging Het
Wdr95 C T 5: 149,487,857 (GRCm39) R164* probably null Het
Zan C A 5: 137,418,251 (GRCm39) C2949F unknown Het
Zbed4 T C 15: 88,665,080 (GRCm39) S383P probably benign Het
Zfand5 T A 19: 21,253,895 (GRCm39) C33S probably damaging Het
Zfp12 A G 5: 143,230,984 (GRCm39) Y437C probably damaging Het
Zfp451 A C 1: 33,852,849 (GRCm39) S22A probably benign Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70,750,408 (GRCm39) missense probably damaging 1.00
IGL01155:Ice1 APN 13 70,752,201 (GRCm39) missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70,753,023 (GRCm39) missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70,772,065 (GRCm39) missense probably damaging 1.00
IGL02423:Ice1 APN 13 70,740,718 (GRCm39) missense probably damaging 1.00
IGL02583:Ice1 APN 13 70,753,854 (GRCm39) missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70,757,278 (GRCm39) missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70,772,593 (GRCm39) splice site probably benign
IGL02929:Ice1 APN 13 70,744,322 (GRCm39) missense probably damaging 1.00
IGL03343:Ice1 APN 13 70,751,048 (GRCm39) missense probably damaging 1.00
IGL03384:Ice1 APN 13 70,751,368 (GRCm39) missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70,772,040 (GRCm39) critical splice donor site probably null
R0078:Ice1 UTSW 13 70,751,467 (GRCm39) missense probably damaging 0.98
R0081:Ice1 UTSW 13 70,767,163 (GRCm39) nonsense probably null
R0281:Ice1 UTSW 13 70,752,166 (GRCm39) missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70,749,310 (GRCm39) missense probably benign 0.08
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0974:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R1033:Ice1 UTSW 13 70,754,713 (GRCm39) missense probably damaging 0.96
R1371:Ice1 UTSW 13 70,744,340 (GRCm39) missense probably damaging 1.00
R1525:Ice1 UTSW 13 70,753,529 (GRCm39) missense probably benign 0.01
R1539:Ice1 UTSW 13 70,754,023 (GRCm39) missense probably damaging 1.00
R1596:Ice1 UTSW 13 70,753,014 (GRCm39) missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70,751,472 (GRCm39) missense probably benign 0.01
R1680:Ice1 UTSW 13 70,753,567 (GRCm39) missense probably benign 0.00
R1737:Ice1 UTSW 13 70,754,444 (GRCm39) missense probably damaging 0.99
R1766:Ice1 UTSW 13 70,752,561 (GRCm39) missense possibly damaging 0.78
R1834:Ice1 UTSW 13 70,763,457 (GRCm39) missense probably damaging 0.99
R1840:Ice1 UTSW 13 70,754,337 (GRCm39) missense probably benign 0.00
R1898:Ice1 UTSW 13 70,750,426 (GRCm39) missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70,753,202 (GRCm39) missense probably benign 0.18
R2000:Ice1 UTSW 13 70,750,546 (GRCm39) missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70,753,741 (GRCm39) missense probably benign 0.00
R2293:Ice1 UTSW 13 70,763,076 (GRCm39) missense probably damaging 1.00
R2377:Ice1 UTSW 13 70,750,899 (GRCm39) missense probably damaging 1.00
R2909:Ice1 UTSW 13 70,744,292 (GRCm39) missense probably damaging 1.00
R2965:Ice1 UTSW 13 70,750,697 (GRCm39) missense probably benign 0.31
R3730:Ice1 UTSW 13 70,751,359 (GRCm39) missense probably damaging 1.00
R3886:Ice1 UTSW 13 70,753,489 (GRCm39) missense probably benign 0.00
R3914:Ice1 UTSW 13 70,754,203 (GRCm39) missense probably benign 0.30
R4051:Ice1 UTSW 13 70,751,646 (GRCm39) missense probably damaging 1.00
R4321:Ice1 UTSW 13 70,751,229 (GRCm39) missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70,757,146 (GRCm39) missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70,754,503 (GRCm39) missense probably damaging 1.00
R5078:Ice1 UTSW 13 70,752,969 (GRCm39) missense probably benign
R5431:Ice1 UTSW 13 70,740,769 (GRCm39) missense probably damaging 1.00
R5722:Ice1 UTSW 13 70,763,219 (GRCm39) missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70,754,620 (GRCm39) missense probably benign 0.04
R5914:Ice1 UTSW 13 70,754,496 (GRCm39) missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70,754,850 (GRCm39) missense probably benign
R6253:Ice1 UTSW 13 70,751,283 (GRCm39) missense probably damaging 1.00
R6274:Ice1 UTSW 13 70,742,958 (GRCm39) missense probably damaging 0.97
R6518:Ice1 UTSW 13 70,754,428 (GRCm39) missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70,751,592 (GRCm39) missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70,763,382 (GRCm39) splice site probably null
R6853:Ice1 UTSW 13 70,751,421 (GRCm39) missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70,743,013 (GRCm39) missense probably damaging 1.00
R7032:Ice1 UTSW 13 70,744,283 (GRCm39) missense probably damaging 0.99
R7176:Ice1 UTSW 13 70,772,525 (GRCm39) critical splice donor site probably null
R7352:Ice1 UTSW 13 70,754,221 (GRCm39) nonsense probably null
R7445:Ice1 UTSW 13 70,744,286 (GRCm39) missense
R7646:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70,753,602 (GRCm39) missense probably damaging 1.00
R7650:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7812:Ice1 UTSW 13 70,751,124 (GRCm39) missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70,751,851 (GRCm39) missense probably damaging 1.00
R8129:Ice1 UTSW 13 70,754,320 (GRCm39) missense probably benign 0.02
R8283:Ice1 UTSW 13 70,752,549 (GRCm39) missense probably damaging 0.97
R8303:Ice1 UTSW 13 70,754,526 (GRCm39) missense probably benign 0.04
R8444:Ice1 UTSW 13 70,752,495 (GRCm39) missense probably damaging 1.00
R8474:Ice1 UTSW 13 70,752,566 (GRCm39) missense probably benign 0.42
R8751:Ice1 UTSW 13 70,751,010 (GRCm39) missense probably damaging 1.00
R8887:Ice1 UTSW 13 70,751,050 (GRCm39) missense probably damaging 1.00
R8911:Ice1 UTSW 13 70,740,787 (GRCm39) missense
R8954:Ice1 UTSW 13 70,758,697 (GRCm39) missense probably damaging 1.00
R9345:Ice1 UTSW 13 70,740,758 (GRCm39) missense
R9438:Ice1 UTSW 13 70,754,434 (GRCm39) missense probably benign 0.04
R9452:Ice1 UTSW 13 70,744,462 (GRCm39) missense probably damaging 1.00
X0026:Ice1 UTSW 13 70,740,721 (GRCm39) missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70,753,320 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATGGCACTTCCAGAGGACAC -3'
(R):5'- TGCTACACAGGTATCAGAGAGCGG -3'

Sequencing Primer
(F):5'- ACTCTTCCGAGGCTCTAAGTAG -3'
(R):5'- AGAGGATGAAGCTGTTAGTTGC -3'
Posted On 2014-05-23