Incidental Mutation 'R1774:Ice1'
ID196963
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Nameinteractor of little elongation complex ELL subunit 1
SynonymsBC018507
MMRRC Submission 039805-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R1774 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location70551707-70637634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70604553 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1138 (D1138G)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
Predicted Effect probably damaging
Transcript: ENSMUST00000043493
AA Change: D1138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: D1138G

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,045,541 V312A probably damaging Het
2810408A11Rik A G 11: 69,900,627 V42A probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Angpt1 T A 15: 42,523,616 Q114L probably damaging Het
Apc2 T C 10: 80,309,130 I625T probably damaging Het
Atg2a T C 19: 6,250,598 V735A probably benign Het
Birc6 T A 17: 74,640,013 I2909N probably damaging Het
C7 C G 15: 5,012,075 D450H probably damaging Het
Cachd1 C T 4: 100,964,435 T403I probably damaging Het
Cachd1 T A 4: 100,967,043 F560L probably benign Het
Cacna2d2 A T 9: 107,526,151 Y944F probably benign Het
Cdkal1 C T 13: 29,850,048 D21N probably damaging Het
Col18a1 T C 10: 77,059,981 R901G probably damaging Het
Col27a1 C T 4: 63,225,713 P546L probably damaging Het
Cps1 C T 1: 67,170,882 R624W possibly damaging Het
Cyp11a1 A T 9: 58,018,360 I93F probably benign Het
Cyp2c40 G C 19: 39,786,806 T334R probably damaging Het
Cyp4f37 A G 17: 32,629,890 D244G possibly damaging Het
D630003M21Rik A T 2: 158,220,470 D43E probably damaging Het
Ep400 C A 5: 110,685,491 C1955F unknown Het
Ethe1 G A 7: 24,593,946 V6I probably benign Het
F5 C A 1: 164,192,535 Q860K probably benign Het
Fasn T C 11: 120,817,171 Y685C probably damaging Het
Gga2 T G 7: 122,012,221 D38A probably damaging Het
Gm12794 G A 4: 101,940,458 V18M probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm43302 T A 5: 105,275,794 I438F probably benign Het
Grm1 T A 10: 11,079,866 T225S possibly damaging Het
Hic2 G T 16: 17,258,647 V447L probably damaging Het
Hsf2 G A 10: 57,512,146 C462Y probably damaging Het
Il6 A G 5: 30,019,435 T158A probably benign Het
Inpp5d T A 1: 87,667,889 V120E probably benign Het
Iqca T C 1: 90,080,903 N456S probably benign Het
Itgal T A 7: 127,309,622 probably null Het
Lrrc66 G C 5: 73,610,855 Q248E probably benign Het
Lrrc7 T A 3: 158,160,292 M1271L possibly damaging Het
Lrrc74a T C 12: 86,749,053 S267P probably damaging Het
Map2 T C 1: 66,414,074 S550P probably damaging Het
Mapk8ip3 A T 17: 24,924,145 probably null Het
Mdm4 A C 1: 132,996,646 S246A probably damaging Het
Med23 A G 10: 24,903,686 E887G probably damaging Het
Mgea5 T C 19: 45,776,984 E128G probably benign Het
Mta1 C T 12: 113,128,039 A254V probably damaging Het
Myh2 A G 11: 67,173,474 Y85C possibly damaging Het
Myo1g A G 11: 6,515,988 Y366H probably damaging Het
Nalcn G A 14: 123,278,266 P1708S probably benign Het
Nlrp9c A T 7: 26,394,118 S41T probably benign Het
Nptx2 T A 5: 144,553,438 S226T possibly damaging Het
Nup85 T A 11: 115,582,945 S562T probably benign Het
Nxpe5 T C 5: 138,239,535 V107A probably benign Het
Olfr129 A G 17: 38,055,437 V43A probably benign Het
Olfr273 T A 4: 52,855,674 I280F probably benign Het
Olfr414 A G 1: 174,431,339 T304A probably benign Het
Olfr455 A T 6: 42,538,519 F168I probably damaging Het
Pcdhb12 C T 18: 37,436,442 P214S possibly damaging Het
Pcdhb5 T A 18: 37,322,672 F702I probably damaging Het
Pcnx T C 12: 81,975,320 F1475S probably damaging Het
Pde5a C A 3: 122,729,364 T40N probably benign Het
Pnpla2 T A 7: 141,459,568 V398E probably damaging Het
Rab20 T C 8: 11,454,223 K159R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rgs12 T A 5: 34,966,403 V510D probably benign Het
Rnf219 A G 14: 104,479,662 V425A possibly damaging Het
Slamf6 T C 1: 171,942,587 probably benign Het
Slc27a5 A T 7: 12,997,607 C23* probably null Het
Slc35e2 T C 4: 155,610,164 V56A possibly damaging Het
Slx4ip T C 2: 137,067,723 S143P probably damaging Het
Stat5a C T 11: 100,879,286 S463F probably damaging Het
Svep1 T C 4: 58,146,562 D360G possibly damaging Het
Tas2r143 A T 6: 42,400,371 D45V probably damaging Het
Tdrd5 G T 1: 156,277,509 R516S probably damaging Het
Thy1 A G 9: 44,047,339 D126G probably benign Het
Tspear C T 10: 77,873,185 T415I probably benign Het
Ttll5 C A 12: 85,933,402 T920K probably benign Het
Umod T C 7: 119,477,351 E64G possibly damaging Het
Usf3 A G 16: 44,215,670 N171S probably damaging Het
Vmn1r23 T A 6: 57,926,690 R34S probably damaging Het
Wasf1 C G 10: 40,934,479 P239R possibly damaging Het
Wdr95 C T 5: 149,564,392 R164* probably null Het
Zan C A 5: 137,419,989 C2949F unknown Het
Zbed4 T C 15: 88,780,877 S383P probably benign Het
Zcchc11 T C 4: 108,507,955 F542L probably damaging Het
Zfand5 T A 19: 21,276,531 C33S probably damaging Het
Zfp12 A G 5: 143,245,229 Y437C probably damaging Het
Zfp451 A C 1: 33,813,768 S22A probably benign Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 splice site probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATGGCACTTCCAGAGGACAC -3'
(R):5'- TGCTACACAGGTATCAGAGAGCGG -3'

Sequencing Primer
(F):5'- ACTCTTCCGAGGCTCTAAGTAG -3'
(R):5'- AGAGGATGAAGCTGTTAGTTGC -3'
Posted On2014-05-23