Incidental Mutation 'R1776:Ankle1'
ID 197026
Institutional Source Beutler Lab
Gene Symbol Ankle1
Ensembl Gene ENSMUSG00000046295
Gene Name ankyrin repeat and LEM domain containing 1
Synonyms Ankrd41, 8430438L13Rik
MMRRC Submission 039807-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.392) question?
Stock # R1776 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 71858654-71862548 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 71861918 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 474 (V474F)
Ref Sequence ENSEMBL: ENSMUSP00000112797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002473] [ENSMUST00000119976] [ENSMUST00000120725]
AlphaFold A8VU90
Predicted Effect probably benign
Transcript: ENSMUST00000002473
SMART Domains Protein: ENSMUSP00000002473
Gene: ENSMUSG00000031820

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 321 331 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119976
AA Change: V494F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113162
Gene: ENSMUSG00000046295
AA Change: V494F

DomainStartEndE-ValueType
ANK 6 35 7.52e2 SMART
ANK 39 71 4.01e0 SMART
ANK 75 104 2.37e-2 SMART
ANK 108 139 1.99e2 SMART
low complexity region 177 193 N/A INTRINSIC
Pfam:LEM 282 319 4.6e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120725
AA Change: V474F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112797
Gene: ENSMUSG00000046295
AA Change: V474F

DomainStartEndE-ValueType
ANK 6 35 7.52e2 SMART
ANK 39 71 4.01e0 SMART
ANK 75 104 2.37e-2 SMART
ANK 108 139 1.99e2 SMART
low complexity region 157 173 N/A INTRINSIC
Pfam:LEM 261 300 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136522
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency 98% (86/88)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes no overt phenotype or detectable defects in hematopoiesis. Mouse embryonic fibroblasts do not show an impaired DNA damage response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T C 10: 70,711,058 (GRCm39) noncoding transcript Het
9430097D07Rik T C 2: 32,464,767 (GRCm39) probably benign Het
A2m C G 6: 121,618,383 (GRCm39) F225L probably damaging Het
Adamts19 T A 18: 59,087,692 (GRCm39) I574N probably damaging Het
Ankfn1 T C 11: 89,417,300 (GRCm39) D104G possibly damaging Het
Ankhd1 T A 18: 36,780,361 (GRCm39) N1804K probably benign Het
Arfgap3 A G 15: 83,227,340 (GRCm39) V24A probably benign Het
Asph A T 4: 9,598,773 (GRCm39) S149R probably damaging Het
Cass4 A T 2: 172,269,615 (GRCm39) I568L probably benign Het
Cd84 A G 1: 171,700,317 (GRCm39) T145A possibly damaging Het
Cdx1 G A 18: 61,169,086 (GRCm39) A36V probably benign Het
Cep57 A T 9: 13,730,170 (GRCm39) S123T probably damaging Het
Clca3a2 T A 3: 144,519,681 (GRCm39) Q231L probably damaging Het
Clcnkb T C 4: 141,142,500 (GRCm39) probably benign Het
Crabp2 C A 3: 87,860,301 (GRCm39) T125K probably benign Het
Dennd3 A G 15: 73,426,950 (GRCm39) T776A possibly damaging Het
Dnajb6 T C 5: 29,990,091 (GRCm39) probably benign Het
Dsp T A 13: 38,380,593 (GRCm39) I1847N probably damaging Het
Dync1h1 T C 12: 110,599,362 (GRCm39) probably benign Het
Ecpas A G 4: 58,879,100 (GRCm39) I63T probably damaging Het
Fbn1 A C 2: 125,163,654 (GRCm39) F2067L possibly damaging Het
Fbxo16 T A 14: 65,532,835 (GRCm39) probably null Het
Gm3604 C A 13: 62,517,888 (GRCm39) G157* probably null Het
Gm5250 A G 1: 13,132,564 (GRCm39) noncoding transcript Het
Gpam A G 19: 55,067,007 (GRCm39) S503P possibly damaging Het
Herc4 T A 10: 63,099,950 (GRCm39) C124* probably null Het
Ift27 T C 15: 78,050,181 (GRCm39) D76G probably null Het
Igdcc3 C T 9: 65,090,034 (GRCm39) Q550* probably null Het
Igsf6 T A 7: 120,667,522 (GRCm39) I165F probably damaging Het
Il31ra T C 13: 112,677,773 (GRCm39) I173M probably damaging Het
Kbtbd6 G A 14: 79,690,045 (GRCm39) D247N probably benign Het
Kcnq2 T A 2: 180,742,350 (GRCm39) T394S probably benign Het
Mia2 A G 12: 59,196,361 (GRCm39) probably benign Het
Mvp T C 7: 126,591,933 (GRCm39) Q419R probably benign Het
Mylk A G 16: 34,773,152 (GRCm39) D1250G probably benign Het
Necab1 A G 4: 15,111,267 (GRCm39) Y54H probably damaging Het
Nlk T A 11: 78,477,853 (GRCm39) M297L probably benign Het
Nsl1 G T 1: 190,795,385 (GRCm39) M50I probably benign Het
Numa1 A G 7: 101,660,257 (GRCm39) T441A probably damaging Het
Ofd1 A G X: 165,189,002 (GRCm39) Y755H probably benign Het
Or10d1c G A 9: 38,894,190 (GRCm39) S50F probably damaging Het
Or6c69b C T 10: 129,627,000 (GRCm39) V153I probably benign Het
Or8b12i G A 9: 20,082,105 (GRCm39) T254I probably benign Het
Ovgp1 A T 3: 105,885,114 (GRCm39) H151L possibly damaging Het
Pigz G A 16: 31,763,397 (GRCm39) E152K probably damaging Het
Plxna1 A T 6: 89,312,446 (GRCm39) D779E probably benign Het
Ppil4 A T 10: 7,686,201 (GRCm39) E353V probably benign Het
Ptprq C T 10: 107,520,950 (GRCm39) G741S probably damaging Het
Rplp0 T C 5: 115,700,524 (GRCm39) Y231H probably benign Het
Rps24 A G 14: 24,541,830 (GRCm39) T6A probably damaging Het
Rundc3b T C 5: 8,629,050 (GRCm39) E117G probably damaging Het
Ryr2 A C 13: 11,760,062 (GRCm39) probably null Het
Ryr3 A T 2: 112,787,598 (GRCm39) M198K probably damaging Het
Sdhd T C 9: 50,508,500 (GRCm39) K122R probably benign Het
Senp2 T C 16: 21,861,810 (GRCm39) probably benign Het
Setd3 C A 12: 108,131,420 (GRCm39) G2V probably damaging Het
Sfxn5 A G 6: 85,244,927 (GRCm39) probably benign Het
She T A 3: 89,739,345 (GRCm39) S179T possibly damaging Het
Slc24a2 G A 4: 87,094,526 (GRCm39) T331I probably benign Het
Slc45a3 T C 1: 131,904,694 (GRCm39) W6R possibly damaging Het
Slc9a4 T C 1: 40,668,447 (GRCm39) S697P probably benign Het
Soat1 C T 1: 156,269,991 (GRCm39) V143I probably benign Het
Sp8 T A 12: 118,813,302 (GRCm39) F386I probably damaging Het
Spata31d1b A G 13: 59,864,381 (GRCm39) T510A probably benign Het
Srgap2 T A 1: 131,339,588 (GRCm39) I125F probably damaging Het
Stab2 T A 10: 86,793,680 (GRCm39) I472F possibly damaging Het
Taar7f C T 10: 23,925,546 (GRCm39) R47C probably benign Het
Tbc1d19 T A 5: 54,046,653 (GRCm39) probably null Het
Tbc1d21 T A 9: 58,274,011 (GRCm39) probably benign Het
Tcaf1 A G 6: 42,655,389 (GRCm39) I529T possibly damaging Het
Tgfbr2 A T 9: 116,004,035 (GRCm39) I24N possibly damaging Het
Tgm1 T C 14: 55,946,854 (GRCm39) T385A probably damaging Het
Tgm2 T C 2: 157,973,379 (GRCm39) N244S probably benign Het
Thoc5 T C 11: 4,864,517 (GRCm39) probably benign Het
Tmc2 A T 2: 130,076,789 (GRCm39) I372F probably damaging Het
Tnrc6a A G 7: 122,770,520 (GRCm39) D222G probably damaging Het
Trhde T G 10: 114,636,508 (GRCm39) N233T probably benign Het
Tstd3 T C 4: 21,759,475 (GRCm39) Y99C probably damaging Het
Ttc22 A T 4: 106,496,237 (GRCm39) D429V possibly damaging Het
Ugcg A G 4: 59,207,775 (GRCm39) N38S probably benign Het
Ush2a A G 1: 188,460,400 (GRCm39) I2554V possibly damaging Het
Usp16 A G 16: 87,276,204 (GRCm39) D513G probably damaging Het
Vip T C 10: 5,594,992 (GRCm39) probably null Het
Vmn1r4 A G 6: 56,934,023 (GRCm39) I176V probably benign Het
Zfp804b T C 5: 6,819,806 (GRCm39) T1050A probably damaging Het
Other mutations in Ankle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Ankle1 APN 8 71,858,903 (GRCm39) missense probably damaging 1.00
IGL02558:Ankle1 APN 8 71,861,636 (GRCm39) missense probably damaging 1.00
IGL02938:Ankle1 APN 8 71,858,896 (GRCm39) missense probably damaging 1.00
R0358:Ankle1 UTSW 8 71,860,189 (GRCm39) missense probably damaging 1.00
R1313:Ankle1 UTSW 8 71,859,857 (GRCm39) missense possibly damaging 0.61
R1313:Ankle1 UTSW 8 71,859,857 (GRCm39) missense possibly damaging 0.61
R1681:Ankle1 UTSW 8 71,860,262 (GRCm39) missense probably benign 0.00
R2070:Ankle1 UTSW 8 71,861,988 (GRCm39) missense probably damaging 1.00
R2073:Ankle1 UTSW 8 71,861,973 (GRCm39) missense possibly damaging 0.94
R2116:Ankle1 UTSW 8 71,860,562 (GRCm39) missense probably benign 0.13
R2117:Ankle1 UTSW 8 71,860,562 (GRCm39) missense probably benign 0.13
R4610:Ankle1 UTSW 8 71,859,851 (GRCm39) intron probably benign
R5027:Ankle1 UTSW 8 71,861,623 (GRCm39) missense probably damaging 1.00
R7051:Ankle1 UTSW 8 71,860,387 (GRCm39) missense probably damaging 0.99
R7268:Ankle1 UTSW 8 71,860,189 (GRCm39) missense probably damaging 1.00
R7795:Ankle1 UTSW 8 71,861,337 (GRCm39) missense probably damaging 0.99
R7900:Ankle1 UTSW 8 71,860,061 (GRCm39) missense probably damaging 1.00
R7934:Ankle1 UTSW 8 71,858,899 (GRCm39) missense possibly damaging 0.89
R8046:Ankle1 UTSW 8 71,860,665 (GRCm39) missense probably damaging 1.00
R8118:Ankle1 UTSW 8 71,860,279 (GRCm39) missense probably benign 0.09
R9057:Ankle1 UTSW 8 71,858,961 (GRCm39) missense probably benign 0.00
R9570:Ankle1 UTSW 8 71,859,424 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGTCACATGAAAGGTATCCGAGC -3'
(R):5'- TCCTCTGAAGCTAGAGCTGGGAAC -3'

Sequencing Primer
(F):5'- GGTATCCGAGCTATGAATCCC -3'
(R):5'- TTAGGAACCAGCCAGATGCTC -3'
Posted On 2014-05-23