Mutagenetix > Incidental Mutation

Incidental Mutation 'R1776:Adamts19'

197071

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

039807-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1776 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 58954620 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 574 (I574N)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably damaging
Transcript: ENSMUST00000052907
AA Change: I574N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: I574N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Meta Mutation Damage Score

0.3059

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 94.9%
20x: 91.3%

Validation Efficiency

98% (86/88)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930533K18Rik	T	C	10: 70,875,228		noncoding transcript	Het
9430097D07Rik	T	C	2: 32,574,755		probably benign	Het
A2m	C	G	6: 121,641,424	F225L	probably damaging	Het
AI314180	A	G	4: 58,879,100	I63T	probably damaging	Het
Ankfn1	T	C	11: 89,526,474	D104G	possibly damaging	Het
Ankhd1	T	A	18: 36,647,308	N1804K	probably benign	Het
Ankle1	G	T	8: 71,409,274	V474F	probably damaging	Het
Arfgap3	A	G	15: 83,343,139	V24A	probably benign	Het
Asph	A	T	4: 9,598,773	S149R	probably damaging	Het
Cass4	A	T	2: 172,427,695	I568L	probably benign	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Cdx1	G	A	18: 61,036,014	A36V	probably benign	Het
Cep57	A	T	9: 13,818,874	S123T	probably damaging	Het
Clca3a2	T	A	3: 144,813,920	Q231L	probably damaging	Het
Clcnkb	T	C	4: 141,415,189		probably benign	Het
Crabp2	C	A	3: 87,952,994	T125K	probably benign	Het
Dennd3	A	G	15: 73,555,101	T776A	possibly damaging	Het
Dnajb6	T	C	5: 29,785,093		probably benign	Het
Dsp	T	A	13: 38,196,617	I1847N	probably damaging	Het
Dync1h1	T	C	12: 110,632,928		probably benign	Het
Fbn1	A	C	2: 125,321,734	F2067L	possibly damaging	Het
Fbxo16	T	A	14: 65,295,386		probably null	Het
Gm3604	C	A	13: 62,370,074	G157*	probably null	Het
Gm5250	A	G	1: 13,062,340		noncoding transcript	Het
Gpam	A	G	19: 55,078,575	S503P	possibly damaging	Het
Herc4	T	A	10: 63,264,171	C124*	probably null	Het
Ift27	T	C	15: 78,165,981	D76G	probably null	Het
Igdcc3	C	T	9: 65,182,752	Q550*	probably null	Het
Igsf6	T	A	7: 121,068,299	I165F	probably damaging	Het
Il31ra	T	C	13: 112,541,239	I173M	probably damaging	Het
Kbtbd6	G	A	14: 79,452,605	D247N	probably benign	Het
Kcnq2	T	A	2: 181,100,557	T394S	probably benign	Het
Mia2	A	G	12: 59,149,575		probably benign	Het
Mvp	T	C	7: 126,992,761	Q419R	probably benign	Het
Mylk	A	G	16: 34,952,782	D1250G	probably benign	Het
Necab1	A	G	4: 15,111,267	Y54H	probably damaging	Het
Nlk	T	A	11: 78,587,027	M297L	probably benign	Het
Nsl1	G	T	1: 191,063,188	M50I	probably benign	Het
Numa1	A	G	7: 102,011,050	T441A	probably damaging	Het
Ofd1	A	G	X: 166,406,006	Y755H	probably benign	Het
Olfr810	C	T	10: 129,791,131	V153I	probably benign	Het
Olfr870	G	A	9: 20,170,809	T254I	probably benign	Het
Olfr934	G	A	9: 38,982,894	S50F	probably damaging	Het
Ovgp1	A	T	3: 105,977,798	H151L	possibly damaging	Het
Pigz	G	A	16: 31,944,579	E152K	probably damaging	Het
Plxna1	A	T	6: 89,335,464	D779E	probably benign	Het
Ppil4	A	T	10: 7,810,437	E353V	probably benign	Het
Ptprq	C	T	10: 107,685,089	G741S	probably damaging	Het
Rplp0	T	C	5: 115,562,465	Y231H	probably benign	Het
Rps24	A	G	14: 24,491,762	T6A	probably damaging	Het
Rundc3b	T	C	5: 8,579,050	E117G	probably damaging	Het
Ryr2	A	C	13: 11,745,176		probably null	Het
Ryr3	A	T	2: 112,957,253	M198K	probably damaging	Het
Sdhd	T	C	9: 50,597,200	K122R	probably benign	Het
Senp2	T	C	16: 22,043,060		probably benign	Het
Setd3	C	A	12: 108,165,161	G2V	probably damaging	Het
Sfxn5	A	G	6: 85,267,945		probably benign	Het
She	T	A	3: 89,832,038	S179T	possibly damaging	Het
Slc24a2	G	A	4: 87,176,289	T331I	probably benign	Het
Slc45a3	T	C	1: 131,976,956	W6R	possibly damaging	Het
Slc9a4	T	C	1: 40,629,287	S697P	probably benign	Het
Soat1	C	T	1: 156,442,421	V143I	probably benign	Het
Sp8	T	A	12: 118,849,567	F386I	probably damaging	Het
Spata31d1b	A	G	13: 59,716,567	T510A	probably benign	Het
Srgap2	T	A	1: 131,411,850	I125F	probably damaging	Het
Stab2	T	A	10: 86,957,816	I472F	possibly damaging	Het
Taar7f	C	T	10: 24,049,648	R47C	probably benign	Het
Tbc1d19	T	A	5: 53,889,311		probably null	Het
Tbc1d21	T	A	9: 58,366,728		probably benign	Het
Tcaf1	A	G	6: 42,678,455	I529T	possibly damaging	Het
Tgfbr2	A	T	9: 116,174,967	I24N	possibly damaging	Het
Tgm1	T	C	14: 55,709,397	T385A	probably damaging	Het
Tgm2	T	C	2: 158,131,459	N244S	probably benign	Het
Thoc5	T	C	11: 4,914,517		probably benign	Het
Tmc2	A	T	2: 130,234,869	I372F	probably damaging	Het
Tnrc6a	A	G	7: 123,171,297	D222G	probably damaging	Het
Trhde	T	G	10: 114,800,603	N233T	probably benign	Het
Tstd3	T	C	4: 21,759,475	Y99C	probably damaging	Het
Ttc22	A	T	4: 106,639,040	D429V	possibly damaging	Het
Ugcg	A	G	4: 59,207,775	N38S	probably benign	Het
Ush2a	A	G	1: 188,728,203	I2554V	possibly damaging	Het
Usp16	A	G	16: 87,479,316	D513G	probably damaging	Het
Vip	T	C	10: 5,644,992		probably null	Het
Vmn1r4	A	G	6: 56,957,038	I176V	probably benign	Het
Zfp804b	T	C	5: 6,769,806	T1050A	probably damaging	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- GTCTTCAATGGCAGAGCTACTAAGTGTT -3'
(R):5'- GTGGCCCTCAGGAAGGTTGTAGA -3'

Sequencing Primer
(F):5'- tCACGAAACTGTTTCTTCTAAGAAAG -3'
(R):5'- CTGGGTTGGATTGCCCAAATAC -3'

Posted On

2014-05-23