Incidental Mutation 'R1777:Klk1b4'
List |< first << previous [record 31 of 92] next >> last >|
ID197114
Institutional Source Beutler Lab
Gene Symbol Klk1b4
Ensembl Gene ENSMUSG00000066513
Gene Namekallikrein 1-related pepidase b4
SynonymsNgfa, mGk-4, Ngfa
MMRRC Submission 039808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1777 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44207435-44211754 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to G at 44207451 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077354]
PDB Structure
CRYSTAL STRUCTURE OF 7S NGF: A COMPLEX OF NERVE GROWTH FACTOR WITH FOUR BINDING PROTEINS (SERINE PROTEINASES) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000077354
SMART Domains Protein: ENSMUSP00000076576
Gene: ENSMUSG00000066513

DomainStartEndE-ValueType
Tryp_SPc 10 248 5.88e-81 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206892
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha subunit of the 7S nerve growth factor (NGF) complex that is essential for the differentiation and survival of distinct populations of neurons in both the central and the peripheral nervous systems. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik T A 1: 16,078,589 D111V possibly damaging Het
Ap2a1 G A 7: 44,904,152 T597M probably damaging Het
Arhgap25 A G 6: 87,463,307 S364P probably benign Het
Atp6v1a G T 16: 44,114,705 Y40* probably null Het
Cdh1 T A 8: 106,656,835 H235Q probably damaging Het
Cntln A G 4: 85,130,679 E1376G probably benign Het
Cntnap5b T A 1: 100,370,078 S781T probably benign Het
Cpne4 A G 9: 104,872,688 T64A probably damaging Het
Ctsg T C 14: 56,100,601 Y179C probably damaging Het
Cx3cr1 A G 9: 120,051,593 Y248H probably damaging Het
Dhx37 T C 5: 125,429,931 E167G probably benign Het
Dnajc21 C A 15: 10,449,607 A443S probably benign Het
Drd5 T C 5: 38,320,161 S166P probably damaging Het
Dscaml1 T C 9: 45,683,756 L719P possibly damaging Het
Eif2ak4 T C 2: 118,430,839 I542T probably damaging Het
Ephb3 G A 16: 21,217,235 G291E probably damaging Het
Eva1a T A 6: 82,092,156 Y155N probably damaging Het
Exog C T 9: 119,449,818 P189L probably damaging Het
Fam13b A G 18: 34,457,760 V455A possibly damaging Het
Fam192a T C 8: 94,588,811 E31G probably damaging Het
Fam35a C A 14: 34,268,173 V259L probably benign Het
Fmn2 C A 1: 174,581,922 Q574K unknown Het
Gm10037 A T 13: 67,833,865 R65S probably benign Het
Gm6871 A T 7: 41,545,719 S531R probably benign Het
Golga2 T A 2: 32,305,470 probably null Het
Hydin C T 8: 110,589,571 P4365L probably benign Het
Ints8 A T 4: 11,225,600 probably null Het
Kbtbd12 A C 6: 88,618,060 S263A probably benign Het
Kcng4 T C 8: 119,633,487 D50G probably benign Het
Klhl18 A T 9: 110,437,401 C217S probably benign Het
Klk7 G A 7: 43,813,329 C186Y probably damaging Het
Krit1 T C 5: 3,836,799 Y635H probably damaging Het
Lipo4 A T 19: 33,499,321 D342E probably damaging Het
Lsm14b T G 2: 180,031,795 D199E probably benign Het
Map3k4 A T 17: 12,271,730 N271K possibly damaging Het
Mast1 T A 8: 84,912,068 N1544I probably benign Het
Megf6 T A 4: 154,270,690 C1487* probably null Het
Mlh3 C A 12: 85,268,754 K219N possibly damaging Het
Mtmr4 A G 11: 87,602,830 K305E probably damaging Het
Myo15 A G 11: 60,514,936 M3105V probably benign Het
Nbas A T 12: 13,513,562 I1958F probably benign Het
Nepro A T 16: 44,735,853 Q458L probably damaging Het
Olfr1309 T A 2: 111,983,697 I126L possibly damaging Het
Olfr198 A G 16: 59,202,016 S137P probably benign Het
Olfr295 T A 7: 86,586,064 I263N probably benign Het
Olfr583 T C 7: 103,051,376 I26T probably benign Het
Olfr741 T A 14: 50,486,300 F281I probably benign Het
Olfr874 A G 9: 37,746,311 Y59C possibly damaging Het
Opa3 T C 7: 19,244,912 Y101H probably damaging Het
Pate3 T C 9: 35,648,116 N2D probably benign Het
Pcdhb21 T A 18: 37,515,718 D633E possibly damaging Het
Pgm1 C T 5: 64,127,782 P589L probably benign Het
Pigg T A 5: 108,317,391 D163E probably damaging Het
Polq A G 16: 37,060,224 T638A possibly damaging Het
Prmt3 T A 7: 49,798,346 M268K possibly damaging Het
Prmt9 T C 8: 77,565,108 C370R probably benign Het
Prss57 A T 10: 79,787,385 V76E possibly damaging Het
Pzp T C 6: 128,490,572 E1089G possibly damaging Het
Qars T A 9: 108,508,201 probably null Het
Ralgapb T C 2: 158,462,195 Y625H probably damaging Het
Rgl2 G A 17: 33,931,744 D59N probably benign Het
Robo1 T G 16: 73,004,667 W1060G probably benign Het
Scaper A T 9: 55,864,546 V362E probably benign Het
Schip1 T C 3: 68,617,684 F131S probably damaging Het
Sh2b2 A T 5: 136,227,422 V252D probably damaging Het
Slc17a6 A T 7: 51,646,209 H199L possibly damaging Het
Slc29a1 A G 17: 45,587,308 Y325H probably damaging Het
Slc29a4 G T 5: 142,714,062 W156L probably damaging Het
Slc5a3 T A 16: 92,077,756 S234T probably benign Het
Srd5a3 T G 5: 76,149,783 V20G probably damaging Het
Stac A T 9: 111,604,082 S223T possibly damaging Het
Sytl2 A T 7: 90,403,052 T766S probably benign Het
Tas2r102 A G 6: 132,762,291 D54G probably benign Het
Tbpl1 A G 10: 22,707,843 V105A probably damaging Het
Tenm3 G T 8: 48,417,179 P193Q probably benign Het
Tes G A 6: 17,104,755 V403M probably benign Het
Tgfbr2 A C 9: 116,109,880 I318S probably damaging Het
Tgfbr3 C A 5: 107,136,930 V618L probably benign Het
Tmc1 C T 19: 20,816,109 probably null Het
Tmem132a G A 19: 10,858,506 H887Y probably damaging Het
Tmem43 C A 6: 91,477,330 S33* probably null Het
Tob1 A G 11: 94,213,754 K39E probably damaging Het
Unc79 T A 12: 103,112,455 D1433E probably damaging Het
Usp25 T C 16: 77,081,554 M622T probably damaging Het
Vmn1r158 A T 7: 22,790,430 L118Q probably damaging Het
Vmn1r217 T A 13: 23,114,325 I136L probably benign Het
Vmn2r15 A T 5: 109,294,270 I99K possibly damaging Het
Vwa7 T A 17: 35,024,948 V786E probably damaging Het
Xkr5 A G 8: 18,939,132 F248S probably benign Het
Zcchc6 A T 13: 59,791,821 H705Q probably damaging Het
Zzef1 A T 11: 72,910,272 K2444M probably damaging Het
Other mutations in Klk1b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Klk1b4 APN 7 44211032 splice site probably benign
IGL00572:Klk1b4 APN 7 44210774 missense possibly damaging 0.79
IGL01314:Klk1b4 APN 7 44211176 critical splice donor site probably null
IGL02252:Klk1b4 APN 7 44210670 nonsense probably null
IGL03006:Klk1b4 APN 7 44211595 missense probably benign 0.08
R0255:Klk1b4 UTSW 7 44210734 missense probably benign 0.00
R0277:Klk1b4 UTSW 7 44211629 missense possibly damaging 0.78
R0931:Klk1b4 UTSW 7 44211056 missense probably damaging 1.00
R1718:Klk1b4 UTSW 7 44209672 missense probably damaging 1.00
R1894:Klk1b4 UTSW 7 44209630 missense probably benign
R1924:Klk1b4 UTSW 7 44209681 missense probably benign 0.00
R3979:Klk1b4 UTSW 7 44211593 missense probably damaging 1.00
R4044:Klk1b4 UTSW 7 44210755 missense probably benign 0.03
R5011:Klk1b4 UTSW 7 44211068 missense probably benign 0.01
R5013:Klk1b4 UTSW 7 44211068 missense probably benign 0.01
R5794:Klk1b4 UTSW 7 44209645 missense probably damaging 0.99
R7122:Klk1b4 UTSW 7 44211107 missense probably damaging 1.00
R7192:Klk1b4 UTSW 7 44209621 missense probably benign 0.44
R7595:Klk1b4 UTSW 7 44210708 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCAGGAAGTACAACTCTGTCAGC -3'
(R):5'- TGTGGGGAACACACCTGAAAGC -3'

Sequencing Primer
(F):5'- TCTGTCAGCACGAACAGAG -3'
(R):5'- TATGCTCGGTGCAAGGAC -3'
Posted On2014-05-23