Incidental Mutation 'R1777:Prmt3'
ID197116
Institutional Source Beutler Lab
Gene Symbol Prmt3
Ensembl Gene ENSMUSG00000030505
Gene Nameprotein arginine N-methyltransferase 3
SynonymsHrmt1l3, 2010005E20Rik, 2410018A17Rik
MMRRC Submission 039808-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.677) question?
Stock #R1777 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location49778346-49858265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49798346 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 268 (M268K)
Ref Sequence ENSEMBL: ENSMUSP00000032715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032715] [ENSMUST00000147401]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032715
AA Change: M268K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032715
Gene: ENSMUSG00000030505
AA Change: M268K

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
ZnF_C2H2 46 69 2.41e1 SMART
coiled coil region 156 191 N/A INTRINSIC
Pfam:PRMT5 212 508 5.7e-8 PFAM
Pfam:Methyltransf_9 220 392 9.3e-9 PFAM
Pfam:MTS 242 326 5.4e-7 PFAM
Pfam:PrmA 245 343 4.3e-13 PFAM
Pfam:Methyltransf_31 250 407 8.8e-11 PFAM
Pfam:Methyltransf_18 252 360 2.5e-11 PFAM
Pfam:Methyltransf_11 257 356 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130907
SMART Domains Protein: ENSMUSP00000114676
Gene: ENSMUSG00000030505

DomainStartEndE-ValueType
PDB:1F3L|A 1 135 3e-93 PDB
SCOP:d1f3la_ 2 135 2e-17 SMART
Blast:FBG 73 118 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147401
SMART Domains Protein: ENSMUSP00000115155
Gene: ENSMUSG00000030505

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
PDB:1WIR|A 38 64 1e-13 PDB
Blast:ZnF_C2H2 46 64 1e-5 BLAST
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protein arginine methyltransferase (PRMT) family. The encoded enzyme catalyzes the methylation of guanidino nitrogens of arginyl residues of proteins. The enzyme acts on 40S ribosomal protein S2 (rpS2), which is its major in-vivo substrate, and is involved in the proper maturation of the 80S ribosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit a reduced embryonic size but survive birth and attain a normal size in adulthood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik T A 1: 16,078,589 D111V possibly damaging Het
Ap2a1 G A 7: 44,904,152 T597M probably damaging Het
Arhgap25 A G 6: 87,463,307 S364P probably benign Het
Atp6v1a G T 16: 44,114,705 Y40* probably null Het
Cdh1 T A 8: 106,656,835 H235Q probably damaging Het
Cntln A G 4: 85,130,679 E1376G probably benign Het
Cntnap5b T A 1: 100,370,078 S781T probably benign Het
Cpne4 A G 9: 104,872,688 T64A probably damaging Het
Ctsg T C 14: 56,100,601 Y179C probably damaging Het
Cx3cr1 A G 9: 120,051,593 Y248H probably damaging Het
Dhx37 T C 5: 125,429,931 E167G probably benign Het
Dnajc21 C A 15: 10,449,607 A443S probably benign Het
Drd5 T C 5: 38,320,161 S166P probably damaging Het
Dscaml1 T C 9: 45,683,756 L719P possibly damaging Het
Eif2ak4 T C 2: 118,430,839 I542T probably damaging Het
Ephb3 G A 16: 21,217,235 G291E probably damaging Het
Eva1a T A 6: 82,092,156 Y155N probably damaging Het
Exog C T 9: 119,449,818 P189L probably damaging Het
Fam13b A G 18: 34,457,760 V455A possibly damaging Het
Fam192a T C 8: 94,588,811 E31G probably damaging Het
Fam35a C A 14: 34,268,173 V259L probably benign Het
Fmn2 C A 1: 174,581,922 Q574K unknown Het
Gm10037 A T 13: 67,833,865 R65S probably benign Het
Gm6871 A T 7: 41,545,719 S531R probably benign Het
Golga2 T A 2: 32,305,470 probably null Het
Hydin C T 8: 110,589,571 P4365L probably benign Het
Ints8 A T 4: 11,225,600 probably null Het
Kbtbd12 A C 6: 88,618,060 S263A probably benign Het
Kcng4 T C 8: 119,633,487 D50G probably benign Het
Klhl18 A T 9: 110,437,401 C217S probably benign Het
Klk1b4 A G 7: 44,207,451 probably benign Het
Klk7 G A 7: 43,813,329 C186Y probably damaging Het
Krit1 T C 5: 3,836,799 Y635H probably damaging Het
Lipo4 A T 19: 33,499,321 D342E probably damaging Het
Lsm14b T G 2: 180,031,795 D199E probably benign Het
Map3k4 A T 17: 12,271,730 N271K possibly damaging Het
Mast1 T A 8: 84,912,068 N1544I probably benign Het
Megf6 T A 4: 154,270,690 C1487* probably null Het
Mlh3 C A 12: 85,268,754 K219N possibly damaging Het
Mtmr4 A G 11: 87,602,830 K305E probably damaging Het
Myo15 A G 11: 60,514,936 M3105V probably benign Het
Nbas A T 12: 13,513,562 I1958F probably benign Het
Nepro A T 16: 44,735,853 Q458L probably damaging Het
Olfr1309 T A 2: 111,983,697 I126L possibly damaging Het
Olfr198 A G 16: 59,202,016 S137P probably benign Het
Olfr295 T A 7: 86,586,064 I263N probably benign Het
Olfr583 T C 7: 103,051,376 I26T probably benign Het
Olfr741 T A 14: 50,486,300 F281I probably benign Het
Olfr874 A G 9: 37,746,311 Y59C possibly damaging Het
Opa3 T C 7: 19,244,912 Y101H probably damaging Het
Pate3 T C 9: 35,648,116 N2D probably benign Het
Pcdhb21 T A 18: 37,515,718 D633E possibly damaging Het
Pgm1 C T 5: 64,127,782 P589L probably benign Het
Pigg T A 5: 108,317,391 D163E probably damaging Het
Polq A G 16: 37,060,224 T638A possibly damaging Het
Prmt9 T C 8: 77,565,108 C370R probably benign Het
Prss57 A T 10: 79,787,385 V76E possibly damaging Het
Pzp T C 6: 128,490,572 E1089G possibly damaging Het
Qars T A 9: 108,508,201 probably null Het
Ralgapb T C 2: 158,462,195 Y625H probably damaging Het
Rgl2 G A 17: 33,931,744 D59N probably benign Het
Robo1 T G 16: 73,004,667 W1060G probably benign Het
Scaper A T 9: 55,864,546 V362E probably benign Het
Schip1 T C 3: 68,617,684 F131S probably damaging Het
Sh2b2 A T 5: 136,227,422 V252D probably damaging Het
Slc17a6 A T 7: 51,646,209 H199L possibly damaging Het
Slc29a1 A G 17: 45,587,308 Y325H probably damaging Het
Slc29a4 G T 5: 142,714,062 W156L probably damaging Het
Slc5a3 T A 16: 92,077,756 S234T probably benign Het
Srd5a3 T G 5: 76,149,783 V20G probably damaging Het
Stac A T 9: 111,604,082 S223T possibly damaging Het
Sytl2 A T 7: 90,403,052 T766S probably benign Het
Tas2r102 A G 6: 132,762,291 D54G probably benign Het
Tbpl1 A G 10: 22,707,843 V105A probably damaging Het
Tenm3 G T 8: 48,417,179 P193Q probably benign Het
Tes G A 6: 17,104,755 V403M probably benign Het
Tgfbr2 A C 9: 116,109,880 I318S probably damaging Het
Tgfbr3 C A 5: 107,136,930 V618L probably benign Het
Tmc1 C T 19: 20,816,109 probably null Het
Tmem132a G A 19: 10,858,506 H887Y probably damaging Het
Tmem43 C A 6: 91,477,330 S33* probably null Het
Tob1 A G 11: 94,213,754 K39E probably damaging Het
Unc79 T A 12: 103,112,455 D1433E probably damaging Het
Usp25 T C 16: 77,081,554 M622T probably damaging Het
Vmn1r158 A T 7: 22,790,430 L118Q probably damaging Het
Vmn1r217 T A 13: 23,114,325 I136L probably benign Het
Vmn2r15 A T 5: 109,294,270 I99K possibly damaging Het
Vwa7 T A 17: 35,024,948 V786E probably damaging Het
Xkr5 A G 8: 18,939,132 F248S probably benign Het
Zcchc6 A T 13: 59,791,821 H705Q probably damaging Het
Zzef1 A T 11: 72,910,272 K2444M probably damaging Het
Other mutations in Prmt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Prmt3 APN 7 49792009 missense probably damaging 1.00
IGL01444:Prmt3 APN 7 49780372 missense probably benign 0.00
IGL01688:Prmt3 APN 7 49848732 splice site probably null
IGL02041:Prmt3 APN 7 49828963 missense possibly damaging 0.91
IGL02304:Prmt3 APN 7 49826737 missense probably benign 0.44
IGL02389:Prmt3 APN 7 49848758 nonsense probably null
IGL02879:Prmt3 APN 7 49818063 missense probably benign 0.39
K7894:Prmt3 UTSW 7 49826711 missense probably damaging 1.00
R0616:Prmt3 UTSW 7 49787328 missense probably damaging 1.00
R0667:Prmt3 UTSW 7 49791995 missense probably damaging 1.00
R1170:Prmt3 UTSW 7 49848547 critical splice donor site probably null
R1343:Prmt3 UTSW 7 49818108 missense probably benign 0.19
R1562:Prmt3 UTSW 7 49826854 missense probably benign 0.00
R1614:Prmt3 UTSW 7 49826719 missense possibly damaging 0.95
R3113:Prmt3 UTSW 7 49782012 missense probably damaging 1.00
R4170:Prmt3 UTSW 7 49826776 missense probably benign 0.01
R4403:Prmt3 UTSW 7 49780357 missense probably damaging 1.00
R4463:Prmt3 UTSW 7 49818089 missense probably damaging 1.00
R4962:Prmt3 UTSW 7 49826809 missense probably benign 0.00
R5144:Prmt3 UTSW 7 49786135 missense possibly damaging 0.48
R5364:Prmt3 UTSW 7 49848806 missense probably damaging 1.00
R5586:Prmt3 UTSW 7 49826751 missense probably damaging 1.00
R5624:Prmt3 UTSW 7 49780334 missense probably damaging 0.97
R5820:Prmt3 UTSW 7 49848806 missense probably damaging 1.00
R5992:Prmt3 UTSW 7 49828947 missense probably benign 0.00
R6931:Prmt3 UTSW 7 49829016 missense probably benign 0.00
R7117:Prmt3 UTSW 7 49818095 missense probably benign 0.00
X0064:Prmt3 UTSW 7 49781974 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGTGCTGGCCGTGGAATTAC -3'
(R):5'- TGTCAGGATGACTGGGCACGAAAC -3'

Sequencing Primer
(F):5'- TGGTGGCCTAATTGCAGAATAC -3'
(R):5'- TCAACACAGCGTTAGGCTTTAC -3'
Posted On2014-05-23