Incidental Mutation 'R1777:Tenm3'
ID 197124
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Name teneurin transmembrane protein 3
Synonyms Ten-m3, Odz3, 2610100B16Rik
MMRRC Submission 039808-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.598) question?
Stock # R1777 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 48227682-48843951 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 48417179 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 193 (P193Q)
Ref Sequence ENSEMBL: ENSMUSP00000033965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000110343] [ENSMUST00000110345] [ENSMUST00000110346] [ENSMUST00000190840] [ENSMUST00000211976]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033965
AA Change: P193Q

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: P193Q

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110343
SMART Domains Protein: ENSMUSP00000105972
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 2.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110345
SMART Domains Protein: ENSMUSP00000105974
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 2.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110346
SMART Domains Protein: ENSMUSP00000105975
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 1.1e-14 PFAM
transmembrane domain 37 59 N/A INTRINSIC
EGF 245 273 2.32e-1 SMART
EGF_like 276 304 4.11e1 SMART
EGF 309 338 1.69e1 SMART
EGF 341 370 1.35e-2 SMART
EGF 375 405 6.11e-1 SMART
EGF 408 436 7.95e0 SMART
EGF 439 467 1.28e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000190840
AA Change: P193Q
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: P193Q

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211976
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik T A 1: 16,078,589 D111V possibly damaging Het
Ap2a1 G A 7: 44,904,152 T597M probably damaging Het
Arhgap25 A G 6: 87,463,307 S364P probably benign Het
Atp6v1a G T 16: 44,114,705 Y40* probably null Het
Cdh1 T A 8: 106,656,835 H235Q probably damaging Het
Cntln A G 4: 85,130,679 E1376G probably benign Het
Cntnap5b T A 1: 100,370,078 S781T probably benign Het
Cpne4 A G 9: 104,872,688 T64A probably damaging Het
Ctsg T C 14: 56,100,601 Y179C probably damaging Het
Cx3cr1 A G 9: 120,051,593 Y248H probably damaging Het
Dhx37 T C 5: 125,429,931 E167G probably benign Het
Dnajc21 C A 15: 10,449,607 A443S probably benign Het
Drd5 T C 5: 38,320,161 S166P probably damaging Het
Dscaml1 T C 9: 45,683,756 L719P possibly damaging Het
Eif2ak4 T C 2: 118,430,839 I542T probably damaging Het
Ephb3 G A 16: 21,217,235 G291E probably damaging Het
Eva1a T A 6: 82,092,156 Y155N probably damaging Het
Exog C T 9: 119,449,818 P189L probably damaging Het
Fam13b A G 18: 34,457,760 V455A possibly damaging Het
Fam192a T C 8: 94,588,811 E31G probably damaging Het
Fam35a C A 14: 34,268,173 V259L probably benign Het
Fmn2 C A 1: 174,581,922 Q574K unknown Het
Gm10037 A T 13: 67,833,865 R65S probably benign Het
Gm6871 A T 7: 41,545,719 S531R probably benign Het
Golga2 T A 2: 32,305,470 probably null Het
Hydin C T 8: 110,589,571 P4365L probably benign Het
Ints8 A T 4: 11,225,600 probably null Het
Kbtbd12 A C 6: 88,618,060 S263A probably benign Het
Kcng4 T C 8: 119,633,487 D50G probably benign Het
Klhl18 A T 9: 110,437,401 C217S probably benign Het
Klk1b4 A G 7: 44,207,451 probably benign Het
Klk7 G A 7: 43,813,329 C186Y probably damaging Het
Krit1 T C 5: 3,836,799 Y635H probably damaging Het
Lipo4 A T 19: 33,499,321 D342E probably damaging Het
Lsm14b T G 2: 180,031,795 D199E probably benign Het
Map3k4 A T 17: 12,271,730 N271K possibly damaging Het
Mast1 T A 8: 84,912,068 N1544I probably benign Het
Megf6 T A 4: 154,270,690 C1487* probably null Het
Mlh3 C A 12: 85,268,754 K219N possibly damaging Het
Mtmr4 A G 11: 87,602,830 K305E probably damaging Het
Myo15 A G 11: 60,514,936 M3105V probably benign Het
Nbas A T 12: 13,513,562 I1958F probably benign Het
Nepro A T 16: 44,735,853 Q458L probably damaging Het
Olfr1309 T A 2: 111,983,697 I126L possibly damaging Het
Olfr198 A G 16: 59,202,016 S137P probably benign Het
Olfr295 T A 7: 86,586,064 I263N probably benign Het
Olfr583 T C 7: 103,051,376 I26T probably benign Het
Olfr741 T A 14: 50,486,300 F281I probably benign Het
Olfr874 A G 9: 37,746,311 Y59C possibly damaging Het
Opa3 T C 7: 19,244,912 Y101H probably damaging Het
Pate3 T C 9: 35,648,116 N2D probably benign Het
Pcdhb21 T A 18: 37,515,718 D633E possibly damaging Het
Pgm1 C T 5: 64,127,782 P589L probably benign Het
Pigg T A 5: 108,317,391 D163E probably damaging Het
Polq A G 16: 37,060,224 T638A possibly damaging Het
Prmt3 T A 7: 49,798,346 M268K possibly damaging Het
Prmt9 T C 8: 77,565,108 C370R probably benign Het
Prss57 A T 10: 79,787,385 V76E possibly damaging Het
Pzp T C 6: 128,490,572 E1089G possibly damaging Het
Qars T A 9: 108,508,201 probably null Het
Ralgapb T C 2: 158,462,195 Y625H probably damaging Het
Rgl2 G A 17: 33,931,744 D59N probably benign Het
Robo1 T G 16: 73,004,667 W1060G probably benign Het
Scaper A T 9: 55,864,546 V362E probably benign Het
Schip1 T C 3: 68,617,684 F131S probably damaging Het
Sh2b2 A T 5: 136,227,422 V252D probably damaging Het
Slc17a6 A T 7: 51,646,209 H199L possibly damaging Het
Slc29a1 A G 17: 45,587,308 Y325H probably damaging Het
Slc29a4 G T 5: 142,714,062 W156L probably damaging Het
Slc5a3 T A 16: 92,077,756 S234T probably benign Het
Srd5a3 T G 5: 76,149,783 V20G probably damaging Het
Stac A T 9: 111,604,082 S223T possibly damaging Het
Sytl2 A T 7: 90,403,052 T766S probably benign Het
Tas2r102 A G 6: 132,762,291 D54G probably benign Het
Tbpl1 A G 10: 22,707,843 V105A probably damaging Het
Tes G A 6: 17,104,755 V403M probably benign Het
Tgfbr2 A C 9: 116,109,880 I318S probably damaging Het
Tgfbr3 C A 5: 107,136,930 V618L probably benign Het
Tmc1 C T 19: 20,816,109 probably null Het
Tmem132a G A 19: 10,858,506 H887Y probably damaging Het
Tmem43 C A 6: 91,477,330 S33* probably null Het
Tob1 A G 11: 94,213,754 K39E probably damaging Het
Unc79 T A 12: 103,112,455 D1433E probably damaging Het
Usp25 T C 16: 77,081,554 M622T probably damaging Het
Vmn1r158 A T 7: 22,790,430 L118Q probably damaging Het
Vmn1r217 T A 13: 23,114,325 I136L probably benign Het
Vmn2r15 A T 5: 109,294,270 I99K possibly damaging Het
Vwa7 T A 17: 35,024,948 V786E probably damaging Het
Xkr5 A G 8: 18,939,132 F248S probably benign Het
Zcchc6 A T 13: 59,791,821 H705Q probably damaging Het
Zzef1 A T 11: 72,910,272 K2444M probably damaging Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48417060 missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48236025 missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48279042 missense probably benign 0.39
IGL00720:Tenm3 APN 8 48276421 missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48417132 missense probably benign 0.00
IGL00976:Tenm3 APN 8 48256841 missense probably benign 0.14
IGL01469:Tenm3 APN 8 48236423 missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48276645 missense probably benign 0.09
IGL01590:Tenm3 APN 8 48228802 missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48254477 missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48236758 nonsense probably null
IGL01892:Tenm3 APN 8 48276396 missense probably benign 0.09
IGL02098:Tenm3 APN 8 48276576 missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48235476 missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48236694 missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48279198 splice site probably benign
IGL02502:Tenm3 APN 8 48288016 missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48299639 missense probably benign 0.30
IGL02543:Tenm3 APN 8 48298956 missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48276903 missense probably benign 0.02
IGL03037:Tenm3 APN 8 48298878 missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 48646418 missense probably benign 0.05
IGL03268:Tenm3 APN 8 48235523 missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48235346 missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48235607 missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48293657 missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48343345 missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48342659 missense probably damaging 0.99
R0123:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0134:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48341034 missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48236912 splice site probably benign
R0335:Tenm3 UTSW 8 48232105 missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48228975 missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48287791 missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48341160 splice site probably benign
R0573:Tenm3 UTSW 8 48674399 splice site probably benign
R0599:Tenm3 UTSW 8 48277710 missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48276156 missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48236525 missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48236594 missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48335742 missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48298965 missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48228542 missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48235582 missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48240396 missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48287893 missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48276400 missense probably benign
R1455:Tenm3 UTSW 8 48279048 missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48235971 missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48310625 missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48343316 missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48287822 missense probably benign 0.01
R1522:Tenm3 UTSW 8 48395576 missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48228981 missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48236421 missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48228993 missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48279074 missense probably benign 0.09
R1676:Tenm3 UTSW 8 48417119 missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48310634 missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48232104 missense probably damaging 1.00
R1793:Tenm3 UTSW 8 48674544 missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48276256 missense probably benign 0.39
R1863:Tenm3 UTSW 8 48276346 missense probably benign 0.20
R1898:Tenm3 UTSW 8 48310761 missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48236313 missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48228591 missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48228668 missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48342256 critical splice donor site probably null
R2109:Tenm3 UTSW 8 48343349 missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48417006 critical splice donor site probably null
R2190:Tenm3 UTSW 8 48395544 missense probably damaging 1.00
R2204:Tenm3 UTSW 8 48674550 missense probably benign 0.17
R2233:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2234:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2235:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2237:Tenm3 UTSW 8 48342337 missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48287953 missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48240270 missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48228555 missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48277746 missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48349223 missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48349404 missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48395658 missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48293726 missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48235970 missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48313236 critical splice donor site probably null
R4851:Tenm3 UTSW 8 48310621 critical splice donor site probably null
R4867:Tenm3 UTSW 8 48235821 missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48276861 missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48300971 missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48278961 nonsense probably null
R4995:Tenm3 UTSW 8 48229137 missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48235826 missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48342308 missense probably benign 0.14
R5228:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48229198 missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48236855 missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48287831 missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48236564 missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48367377 nonsense probably null
R5566:Tenm3 UTSW 8 48279006 missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48236764 missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48228762 missense probably damaging 1.00
R5931:Tenm3 UTSW 8 48646498 missense probably benign 0.00
R5959:Tenm3 UTSW 8 48646447 nonsense probably null
R5965:Tenm3 UTSW 8 48228508 nonsense probably null
R6062:Tenm3 UTSW 8 48343406 missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48395573 missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48298808 missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48254622 missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48293665 missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48417059 missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48367394 missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48276849 missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48236063 missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48417222 missense probably benign
R6516:Tenm3 UTSW 8 48417222 missense probably benign
R6747:Tenm3 UTSW 8 48343243 missense probably damaging 1.00
R6782:Tenm3 UTSW 8 48646256 critical splice donor site probably null
R6788:Tenm3 UTSW 8 48674493 missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48256837 missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48276738 missense probably benign 0.39
R6913:Tenm3 UTSW 8 48298937 missense probably damaging 0.99
R6941:Tenm3 UTSW 8 48674416 missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48240479 nonsense probably null
R6968:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48240444 missense probably damaging 1.00
R7125:Tenm3 UTSW 8 48674553 missense probably benign 0.00
R7140:Tenm3 UTSW 8 48292236 missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48300969 missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48235935 missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48236177 missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48236183 missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48287812 missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48276600 missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48341049 missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48335727 missense probably benign 0.27
R7734:Tenm3 UTSW 8 48646333 missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48236465 missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48276300 missense probably benign 0.01
R7843:Tenm3 UTSW 8 48229111 nonsense probably null
R7951:Tenm3 UTSW 8 48310703 missense possibly damaging 0.86
R8293:Tenm3 UTSW 8 48367422 missense possibly damaging 0.91
R8336:Tenm3 UTSW 8 48293773 missense probably damaging 1.00
R8351:Tenm3 UTSW 8 48287872 missense probably damaging 0.96
R8387:Tenm3 UTSW 8 48287848 missense probably damaging 0.98
R8414:Tenm3 UTSW 8 48293509 missense probably damaging 1.00
R8451:Tenm3 UTSW 8 48287872 missense probably damaging 0.96
R8465:Tenm3 UTSW 8 48229181 missense probably damaging 1.00
R8528:Tenm3 UTSW 8 48342633 missense probably damaging 1.00
R8717:Tenm3 UTSW 8 48299645 missense possibly damaging 0.77
R8734:Tenm3 UTSW 8 48349356 missense probably benign 0.16
R8781:Tenm3 UTSW 8 48342449 frame shift probably null
R8820:Tenm3 UTSW 8 48310724 missense probably damaging 0.96
R8821:Tenm3 UTSW 8 48276382 missense
R8831:Tenm3 UTSW 8 48276382 missense
R8853:Tenm3 UTSW 8 48342347 missense probably damaging 1.00
R8900:Tenm3 UTSW 8 48236402 missense probably damaging 1.00
R8931:Tenm3 UTSW 8 48235602 missense probably damaging 1.00
R8933:Tenm3 UTSW 8 48279060 missense possibly damaging 0.53
R8989:Tenm3 UTSW 8 48235348 nonsense probably null
R8998:Tenm3 UTSW 8 48276687 missense probably damaging 1.00
R9008:Tenm3 UTSW 8 48342653 missense probably damaging 0.98
R9017:Tenm3 UTSW 8 48254633 missense probably damaging 0.99
R9101:Tenm3 UTSW 8 48292151 missense probably damaging 1.00
R9108:Tenm3 UTSW 8 48313236 critical splice donor site probably null
R9142:Tenm3 UTSW 8 48335513 missense unknown
R9231:Tenm3 UTSW 8 48236196 missense probably damaging 1.00
R9309:Tenm3 UTSW 8 48298937 missense probably damaging 0.99
R9310:Tenm3 UTSW 8 48555900 unclassified probably benign
R9336:Tenm3 UTSW 8 48417080 missense probably damaging 1.00
R9373:Tenm3 UTSW 8 48299655 missense probably damaging 1.00
R9393:Tenm3 UTSW 8 48674524 missense probably damaging 0.99
R9509:Tenm3 UTSW 8 48313257 nonsense probably null
R9575:Tenm3 UTSW 8 48235761 missense possibly damaging 0.94
R9698:Tenm3 UTSW 8 48236211 missense probably damaging 1.00
R9722:Tenm3 UTSW 8 48300814 missense probably benign 0.00
R9788:Tenm3 UTSW 8 48335561 missense probably benign 0.02
X0010:Tenm3 UTSW 8 48287829 missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48236477 missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48276780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACATTACTGCCAAGGACCCAGC -3'
(R):5'- TTTGAGAATGTCACTGAGCAGTCCC -3'

Sequencing Primer
(F):5'- GGTTCCTTCTATTGGTCAGGGA -3'
(R):5'- GTCACTGAGCAGTCCCTTAATAG -3'
Posted On 2014-05-23