Mutagenetix > Incidental Mutation

Incidental Mutation 'R1777:Polq'

197166

Institutional Source

Beutler Lab

Gene Symbol

Polq

Ensembl Gene

ENSMUSG00000034206

Gene Name

polymerase (DNA directed), theta

Synonyms

A430110D14Rik

MMRRC Submission

039808-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.413) question?

Stock #

R1777 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37011786-37095417 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 37060224 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 638 (T638A)

Ref Sequence

ENSEMBL: ENSMUSP00000071396 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]

AlphaFold

Q8CGS6

Predicted Effect

probably benign
Transcript: ENSMUST00000054034
AA Change: T917A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: T917A

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
DEXDc	87	298	4.09e-18	SMART
HELICc	398	484	4.02e-17	SMART
Blast:DEXDc	485	550	2e-25	BLAST
low complexity region	609	626	N/A	INTRINSIC
PDB:2ZJA\|A	712	826	5e-9	PDB
low complexity region	845	852	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
low complexity region	1126	1149	N/A	INTRINSIC
low complexity region	1813	1822	N/A	INTRINSIC
POLAc	2265	2504	3.3e-101	SMART
low complexity region	2521	2531	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071452
AA Change: T638A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: T638A

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
Pfam:DEAD	92	216	5.9e-12	PFAM
low complexity region	330	347	N/A	INTRINSIC
PDB:2ZJA\|A	433	547	5e-9	PDB
low complexity region	566	573	N/A	INTRINSIC
low complexity region	619	632	N/A	INTRINSIC
low complexity region	847	870	N/A	INTRINSIC
low complexity region	1534	1543	N/A	INTRINSIC
POLAc	1986	2225	3.3e-101	SMART
low complexity region	2242	2252	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182622

Predicted Effect

probably benign
Transcript: ENSMUST00000182946

SMART Domains

Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
Pfam:DEAD	92	164	1.3e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183112

SMART Domains

Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
Pfam:DEAD	92	164	1.3e-9	PFAM

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444P10Rik	T	A	1: 16,078,589	D111V	possibly damaging	Het
Ap2a1	G	A	7: 44,904,152	T597M	probably damaging	Het
Arhgap25	A	G	6: 87,463,307	S364P	probably benign	Het
Atp6v1a	G	T	16: 44,114,705	Y40*	probably null	Het
Cdh1	T	A	8: 106,656,835	H235Q	probably damaging	Het
Cntln	A	G	4: 85,130,679	E1376G	probably benign	Het
Cntnap5b	T	A	1: 100,370,078	S781T	probably benign	Het
Cpne4	A	G	9: 104,872,688	T64A	probably damaging	Het
Ctsg	T	C	14: 56,100,601	Y179C	probably damaging	Het
Cx3cr1	A	G	9: 120,051,593	Y248H	probably damaging	Het
Dhx37	T	C	5: 125,429,931	E167G	probably benign	Het
Dnajc21	C	A	15: 10,449,607	A443S	probably benign	Het
Drd5	T	C	5: 38,320,161	S166P	probably damaging	Het
Dscaml1	T	C	9: 45,683,756	L719P	possibly damaging	Het
Eif2ak4	T	C	2: 118,430,839	I542T	probably damaging	Het
Ephb3	G	A	16: 21,217,235	G291E	probably damaging	Het
Eva1a	T	A	6: 82,092,156	Y155N	probably damaging	Het
Exog	C	T	9: 119,449,818	P189L	probably damaging	Het
Fam13b	A	G	18: 34,457,760	V455A	possibly damaging	Het
Fam192a	T	C	8: 94,588,811	E31G	probably damaging	Het
Fam35a	C	A	14: 34,268,173	V259L	probably benign	Het
Fmn2	C	A	1: 174,581,922	Q574K	unknown	Het
Gm10037	A	T	13: 67,833,865	R65S	probably benign	Het
Gm6871	A	T	7: 41,545,719	S531R	probably benign	Het
Golga2	T	A	2: 32,305,470		probably null	Het
Hydin	C	T	8: 110,589,571	P4365L	probably benign	Het
Ints8	A	T	4: 11,225,600		probably null	Het
Kbtbd12	A	C	6: 88,618,060	S263A	probably benign	Het
Kcng4	T	C	8: 119,633,487	D50G	probably benign	Het
Klhl18	A	T	9: 110,437,401	C217S	probably benign	Het
Klk1b4	A	G	7: 44,207,451		probably benign	Het
Klk7	G	A	7: 43,813,329	C186Y	probably damaging	Het
Krit1	T	C	5: 3,836,799	Y635H	probably damaging	Het
Lipo4	A	T	19: 33,499,321	D342E	probably damaging	Het
Lsm14b	T	G	2: 180,031,795	D199E	probably benign	Het
Map3k4	A	T	17: 12,271,730	N271K	possibly damaging	Het
Mast1	T	A	8: 84,912,068	N1544I	probably benign	Het
Megf6	T	A	4: 154,270,690	C1487*	probably null	Het
Mlh3	C	A	12: 85,268,754	K219N	possibly damaging	Het
Mtmr4	A	G	11: 87,602,830	K305E	probably damaging	Het
Myo15	A	G	11: 60,514,936	M3105V	probably benign	Het
Nbas	A	T	12: 13,513,562	I1958F	probably benign	Het
Nepro	A	T	16: 44,735,853	Q458L	probably damaging	Het
Olfr1309	T	A	2: 111,983,697	I126L	possibly damaging	Het
Olfr198	A	G	16: 59,202,016	S137P	probably benign	Het
Olfr295	T	A	7: 86,586,064	I263N	probably benign	Het
Olfr583	T	C	7: 103,051,376	I26T	probably benign	Het
Olfr741	T	A	14: 50,486,300	F281I	probably benign	Het
Olfr874	A	G	9: 37,746,311	Y59C	possibly damaging	Het
Opa3	T	C	7: 19,244,912	Y101H	probably damaging	Het
Pate3	T	C	9: 35,648,116	N2D	probably benign	Het
Pcdhb21	T	A	18: 37,515,718	D633E	possibly damaging	Het
Pgm1	C	T	5: 64,127,782	P589L	probably benign	Het
Pigg	T	A	5: 108,317,391	D163E	probably damaging	Het
Prmt3	T	A	7: 49,798,346	M268K	possibly damaging	Het
Prmt9	T	C	8: 77,565,108	C370R	probably benign	Het
Prss57	A	T	10: 79,787,385	V76E	possibly damaging	Het
Pzp	T	C	6: 128,490,572	E1089G	possibly damaging	Het
Qars	T	A	9: 108,508,201		probably null	Het
Ralgapb	T	C	2: 158,462,195	Y625H	probably damaging	Het
Rgl2	G	A	17: 33,931,744	D59N	probably benign	Het
Robo1	T	G	16: 73,004,667	W1060G	probably benign	Het
Scaper	A	T	9: 55,864,546	V362E	probably benign	Het
Schip1	T	C	3: 68,617,684	F131S	probably damaging	Het
Sh2b2	A	T	5: 136,227,422	V252D	probably damaging	Het
Slc17a6	A	T	7: 51,646,209	H199L	possibly damaging	Het
Slc29a1	A	G	17: 45,587,308	Y325H	probably damaging	Het
Slc29a4	G	T	5: 142,714,062	W156L	probably damaging	Het
Slc5a3	T	A	16: 92,077,756	S234T	probably benign	Het
Srd5a3	T	G	5: 76,149,783	V20G	probably damaging	Het
Stac	A	T	9: 111,604,082	S223T	possibly damaging	Het
Sytl2	A	T	7: 90,403,052	T766S	probably benign	Het
Tas2r102	A	G	6: 132,762,291	D54G	probably benign	Het
Tbpl1	A	G	10: 22,707,843	V105A	probably damaging	Het
Tenm3	G	T	8: 48,417,179	P193Q	probably benign	Het
Tes	G	A	6: 17,104,755	V403M	probably benign	Het
Tgfbr2	A	C	9: 116,109,880	I318S	probably damaging	Het
Tgfbr3	C	A	5: 107,136,930	V618L	probably benign	Het
Tmc1	C	T	19: 20,816,109		probably null	Het
Tmem132a	G	A	19: 10,858,506	H887Y	probably damaging	Het
Tmem43	C	A	6: 91,477,330	S33*	probably null	Het
Tob1	A	G	11: 94,213,754	K39E	probably damaging	Het
Unc79	T	A	12: 103,112,455	D1433E	probably damaging	Het
Usp25	T	C	16: 77,081,554	M622T	probably damaging	Het
Vmn1r158	A	T	7: 22,790,430	L118Q	probably damaging	Het
Vmn1r217	T	A	13: 23,114,325	I136L	probably benign	Het
Vmn2r15	A	T	5: 109,294,270	I99K	possibly damaging	Het
Vwa7	T	A	17: 35,024,948	V786E	probably damaging	Het
Xkr5	A	G	8: 18,939,132	F248S	probably benign	Het
Zcchc6	A	T	13: 59,791,821	H705Q	probably damaging	Het
Zzef1	A	T	11: 72,910,272	K2444M	probably damaging	Het

Other mutations in Polq

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Polq	APN	16	37065247	splice site	probably benign
IGL00539:Polq	APN	16	37060569	missense	probably damaging	0.98
IGL00960:Polq	APN	16	37060512	missense	probably damaging	0.96
IGL01100:Polq	APN	16	37061112	missense	probably benign
IGL01112:Polq	APN	16	37017309	missense	probably damaging	1.00
IGL01138:Polq	APN	16	37045869	missense	possibly damaging	0.94
IGL01432:Polq	APN	16	37071822	splice site	probably benign
IGL01522:Polq	APN	16	37027903	missense	probably damaging	1.00
IGL01565:Polq	APN	16	37013113	missense	probably benign	0.00
IGL01592:Polq	APN	16	37034850	missense	probably benign	0.01
IGL01690:Polq	APN	16	37062838	missense	probably damaging	0.97
IGL01943:Polq	APN	16	37061443	missense	possibly damaging	0.47
IGL02531:Polq	APN	16	37062374	missense	possibly damaging	0.75
IGL02553:Polq	APN	16	37041768	missense	probably damaging	1.00
IGL02623:Polq	APN	16	37060375	missense	probably benign	0.04
IGL02692:Polq	APN	16	37060627	missense	probably damaging	1.00
IGL02717:Polq	APN	16	37022740	missense	probably damaging	1.00
IGL02937:Polq	APN	16	37013109	missense	probably benign	0.14
IGL02959:Polq	APN	16	37086566	missense	probably damaging	1.00
IGL03086:Polq	APN	16	37091049	missense	probably benign	0.02
IGL03141:Polq	APN	16	37017358	splice site	probably benign
IGL03302:Polq	APN	16	37071772	missense	probably damaging	1.00
IGL03393:Polq	APN	16	37044794	missense	probably damaging	1.00
R0013_Polq_667	UTSW	16	37061839	missense	possibly damaging	0.56
R4238_Polq_233	UTSW	16	37013181	missense	probably damaging	1.00
R4280_polq_867	UTSW	16	37082057	missense	probably damaging	1.00
G1Funyon:Polq	UTSW	16	37061819	missense	probably damaging	1.00
PIT4403001:Polq	UTSW	16	37060587	missense	probably benign	0.00
R0013:Polq	UTSW	16	37061839	missense	possibly damaging	0.56
R0082:Polq	UTSW	16	37017257	missense	probably benign	0.01
R0212:Polq	UTSW	16	37066854	missense	probably damaging	0.99
R0387:Polq	UTSW	16	37029430	missense	probably damaging	1.00
R0387:Polq	UTSW	16	37089317	missense	probably damaging	1.00
R0427:Polq	UTSW	16	37061993	nonsense	probably null
R0454:Polq	UTSW	16	37034890	missense	probably damaging	0.98
R0513:Polq	UTSW	16	37094502	missense	probably damaging	1.00
R0622:Polq	UTSW	16	37060993	missense	probably benign	0.02
R0848:Polq	UTSW	16	37062130	missense	probably benign	0.08
R1142:Polq	UTSW	16	37013217	missense	probably damaging	0.98
R1218:Polq	UTSW	16	37029446	missense	possibly damaging	0.93
R1331:Polq	UTSW	16	37041747	missense	probably damaging	1.00
R1398:Polq	UTSW	16	37062495	missense	possibly damaging	0.87
R1424:Polq	UTSW	16	37086528	missense	probably damaging	1.00
R1644:Polq	UTSW	16	37060264	missense	probably damaging	0.96
R1820:Polq	UTSW	16	37029418	missense	possibly damaging	0.48
R1854:Polq	UTSW	16	37062109	missense	probably benign	0.01
R1880:Polq	UTSW	16	37086592	missense	possibly damaging	0.90
R1932:Polq	UTSW	16	37062304	missense	possibly damaging	0.92
R2008:Polq	UTSW	16	37062482	missense	probably damaging	0.96
R2014:Polq	UTSW	16	37078366	missense	probably damaging	1.00
R2026:Polq	UTSW	16	37062745	missense	possibly damaging	0.93
R2178:Polq	UTSW	16	37062829	missense	probably damaging	1.00
R2259:Polq	UTSW	16	37062097	missense	probably benign	0.03
R2266:Polq	UTSW	16	37062153	missense	possibly damaging	0.59
R2305:Polq	UTSW	16	37062337	missense	probably damaging	0.99
R2370:Polq	UTSW	16	37073939	missense	probably damaging	1.00
R2504:Polq	UTSW	16	37011942	missense	unknown
R2517:Polq	UTSW	16	37089325	missense	probably damaging	1.00
R2697:Polq	UTSW	16	37042153	missense	probably damaging	1.00
R2858:Polq	UTSW	16	37062753	missense	possibly damaging	0.88
R3436:Polq	UTSW	16	37062337	missense	probably damaging	0.99
R3437:Polq	UTSW	16	37062337	missense	probably damaging	0.99
R3699:Polq	UTSW	16	37042156	missense	probably damaging	1.00
R3838:Polq	UTSW	16	37078349	missense	probably damaging	1.00
R3875:Polq	UTSW	16	37074027	missense	probably damaging	0.99
R4050:Polq	UTSW	16	37092820	critical splice acceptor site	probably null
R4172:Polq	UTSW	16	37060758	missense	probably benign	0.02
R4238:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4240:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4280:Polq	UTSW	16	37082057	missense	probably damaging	1.00
R4296:Polq	UTSW	16	37061301	missense	possibly damaging	0.94
R4360:Polq	UTSW	16	37060339	missense	probably benign	0.00
R4373:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4375:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4376:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4509:Polq	UTSW	16	37048563	missense	probably damaging	1.00
R4510:Polq	UTSW	16	37048563	missense	probably damaging	1.00
R4511:Polq	UTSW	16	37048563	missense	probably damaging	1.00
R4543:Polq	UTSW	16	37060785	missense	probably benign	0.43
R4633:Polq	UTSW	16	37048542	missense	probably damaging	1.00
R4739:Polq	UTSW	16	37041747	missense	probably damaging	1.00
R4834:Polq	UTSW	16	37027814	missense	probably damaging	1.00
R4841:Polq	UTSW	16	37048783	critical splice donor site	probably null
R4842:Polq	UTSW	16	37048783	critical splice donor site	probably null
R4937:Polq	UTSW	16	37027912	missense	probably benign	0.01
R4955:Polq	UTSW	16	37061082	missense	probably benign	0.32
R4992:Polq	UTSW	16	37061162	missense	possibly damaging	0.59
R5008:Polq	UTSW	16	37062387	missense	probably benign
R5221:Polq	UTSW	16	37042178	missense	probably damaging	0.98
R5254:Polq	UTSW	16	37089319	missense	probably damaging	1.00
R5292:Polq	UTSW	16	37061383	missense	probably damaging	1.00
R5375:Polq	UTSW	16	37082784	missense	probably damaging	1.00
R5480:Polq	UTSW	16	37013290	splice site	probably benign
R5552:Polq	UTSW	16	37094510	missense	possibly damaging	0.93
R5591:Polq	UTSW	16	37011885	utr 5 prime	probably benign
R5653:Polq	UTSW	16	37040534	missense	probably damaging	1.00
R5708:Polq	UTSW	16	37061018	missense	probably damaging	0.98
R5754:Polq	UTSW	16	37017263	missense	probably benign
R5757:Polq	UTSW	16	37086681	missense	probably benign	0.01
R5764:Polq	UTSW	16	37017344	missense	probably damaging	0.97
R6019:Polq	UTSW	16	37061764	missense	probably damaging	1.00
R6170:Polq	UTSW	16	37045812	missense	possibly damaging	0.82
R6177:Polq	UTSW	16	37071709	missense	probably damaging	0.98
R6307:Polq	UTSW	16	37017356	critical splice donor site	probably null
R6499:Polq	UTSW	16	37060827	missense	probably benign	0.03
R6520:Polq	UTSW	16	37060377	missense	possibly damaging	0.88
R6598:Polq	UTSW	16	37061631	missense	probably benign	0.39
R6694:Polq	UTSW	16	37015173	missense	probably null	0.99
R6788:Polq	UTSW	16	37077148	missense	probably damaging	1.00
R7104:Polq	UTSW	16	37089353	nonsense	probably null
R7159:Polq	UTSW	16	37062853	missense	possibly damaging	0.87
R7222:Polq	UTSW	16	37086633	nonsense	probably null
R7340:Polq	UTSW	16	37060926	missense	probably benign	0.00
R7361:Polq	UTSW	16	37060428	missense	probably benign	0.00
R7384:Polq	UTSW	16	37029418	missense	probably damaging	1.00
R7509:Polq	UTSW	16	37060343	missense	probably benign
R7509:Polq	UTSW	16	37060344	missense	probably benign	0.00
R7575:Polq	UTSW	16	37091134	missense	probably benign	0.00
R7785:Polq	UTSW	16	37027877	missense	probably damaging	1.00
R7787:Polq	UTSW	16	37017309	missense	probably damaging	1.00
R7891:Polq	UTSW	16	37027882	missense	probably damaging	1.00
R7898:Polq	UTSW	16	37044883	missense	probably damaging	0.98
R7917:Polq	UTSW	16	37065288	missense	probably benign	0.08
R7940:Polq	UTSW	16	37060642	missense	probably benign	0.27
R8028:Polq	UTSW	16	37061316	missense	possibly damaging	0.82
R8114:Polq	UTSW	16	37042215	missense	possibly damaging	0.94
R8144:Polq	UTSW	16	37029484	missense	probably benign	0.01
R8288:Polq	UTSW	16	37027910	missense	probably damaging	1.00
R8301:Polq	UTSW	16	37061819	missense	probably damaging	1.00
R8341:Polq	UTSW	16	37071771	missense	possibly damaging	0.96
R8348:Polq	UTSW	16	37017197	critical splice acceptor site	probably null
R8448:Polq	UTSW	16	37017197	critical splice acceptor site	probably null
R8815:Polq	UTSW	16	37033531	missense	probably damaging	1.00
R8843:Polq	UTSW	16	37011918	missense	unknown
R8878:Polq	UTSW	16	37040507	missense	probably benign	0.02
R9016:Polq	UTSW	16	37022797	missense	probably damaging	1.00
R9189:Polq	UTSW	16	37044903	missense	probably damaging	1.00
R9209:Polq	UTSW	16	37048649	missense	possibly damaging	0.94
R9352:Polq	UTSW	16	37041890	missense	probably damaging	0.98
R9398:Polq	UTSW	16	37061032	missense	probably benign	0.02
R9403:Polq	UTSW	16	37061853	missense	probably benign	0.00
R9489:Polq	UTSW	16	37022811	missense	probably benign	0.00
R9605:Polq	UTSW	16	37022811	missense	probably benign	0.00
R9664:Polq	UTSW	16	37027814	missense	probably damaging	0.98
R9801:Polq	UTSW	16	37092828	missense	probably damaging	1.00
X0060:Polq	UTSW	16	37017237	nonsense	probably null
Z1176:Polq	UTSW	16	37042257	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTGAATAGTGCCCGGAAGGCAGTG -3'
(R):5'- GGCTCGAAATTGCCCTGGAACTTAC -3'

Sequencing Primer
(F):5'- CGGCGGAGTATGAGAACTATTTG -3'
(R):5'- TTGCCCTGGAACTTACAGAGAG -3'

Posted On

2014-05-23