Incidental Mutation 'R0082:Arhgef1'
ID19717
Institutional Source Beutler Lab
Gene Symbol Arhgef1
Ensembl Gene ENSMUSG00000040940
Gene NameRho guanine nucleotide exchange factor (GEF) 1
SynonymsLbcl2, Lsc
MMRRC Submission 038369-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R0082 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24902912-24926594 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 24912605 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 100 (Q100*)
Ref Sequence ENSEMBL: ENSMUSP00000146065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000132751] [ENSMUST00000151121] [ENSMUST00000205295] [ENSMUST00000206011] [ENSMUST00000206028] [ENSMUST00000206508] [ENSMUST00000206906]
Predicted Effect probably null
Transcript: ENSMUST00000047873
AA Change: Q138*
SMART Domains Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940
AA Change: Q138*

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098683
AA Change: Q138*
SMART Domains Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940
AA Change: Q138*

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 2.2e-78 PFAM
PDB:3ODW|B 238 384 2e-57 PDB
low complexity region 396 412 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
RhoGEF 478 662 1.87e-63 SMART
PH 706 820 4.68e-5 SMART
low complexity region 904 923 N/A INTRINSIC
coiled coil region 926 949 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117419
AA Change: Q138*
SMART Domains Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940
AA Change: Q138*

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117796
AA Change: Q138*
SMART Domains Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940
AA Change: Q138*

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 7.3e-73 PFAM
low complexity region 393 409 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
RhoGEF 475 659 1.87e-63 SMART
PH 703 817 4.68e-5 SMART
low complexity region 901 920 N/A INTRINSIC
coiled coil region 923 946 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127761
Predicted Effect probably benign
Transcript: ENSMUST00000132751
SMART Domains Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 70 89 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 140 160 N/A INTRINSIC
RhoGEF 179 363 1.87e-63 SMART
PH 407 521 4.68e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145783
Predicted Effect probably benign
Transcript: ENSMUST00000151121
SMART Domains Protein: ENSMUSP00000114388
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 101 5.3e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205295
AA Change: Q138*
Predicted Effect probably benign
Transcript: ENSMUST00000206011
Predicted Effect probably benign
Transcript: ENSMUST00000206028
Predicted Effect probably null
Transcript: ENSMUST00000206508
AA Change: Q138*
Predicted Effect probably null
Transcript: ENSMUST00000206906
AA Change: Q100*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.3%
  • 10x: 91.7%
  • 20x: 73.7%
Validation Efficiency 94% (136/144)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik T C 9: 51,101,802 T57A probably benign Het
Adam17 A C 12: 21,329,048 probably benign Het
Adcy1 T C 11: 7,149,497 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ankrd33b T C 15: 31,297,789 N274S probably benign Het
BC030499 T C 11: 78,293,558 S244P probably damaging Het
Ccdc180 A G 4: 45,896,205 D118G probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Cdh4 A T 2: 179,894,188 N844I possibly damaging Het
Cep57 T C 9: 13,810,876 probably benign Het
Dnah7a A T 1: 53,518,708 D2182E probably damaging Het
Dync1h1 A G 12: 110,636,446 T2174A probably benign Het
Eef1akmt2 T A 7: 132,851,472 R44* probably null Het
Evpl T A 11: 116,235,003 I43F probably damaging Het
F13a1 G T 13: 36,988,953 P151Q probably damaging Het
Fam173a T C 17: 25,791,574 I89V probably benign Het
Galnt5 A T 2: 57,999,035 I216F possibly damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gpr139 T A 7: 119,145,045 T106S probably benign Het
Hoxb3 A G 11: 96,344,271 D8G probably damaging Het
Hpse T C 5: 100,692,262 K330E possibly damaging Het
Kcmf1 G T 6: 72,850,487 probably null Het
Klra2 T C 6: 131,220,247 N263S possibly damaging Het
Klra8 T C 6: 130,125,055 D139G probably benign Het
Lrrc46 A C 11: 97,041,077 probably benign Het
Ly86 A T 13: 37,418,537 probably null Het
Mmp20 C T 9: 7,642,807 T214M probably benign Het
Olfr591 G T 7: 103,173,202 A145E probably benign Het
Olfr729 A T 14: 50,148,055 I273K probably damaging Het
Olfr786 T C 10: 129,437,271 I153T possibly damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Pigg A G 5: 108,312,885 probably benign Het
Polq C A 16: 37,017,257 T177K probably benign Het
Pomgnt2 A T 9: 121,982,260 V485E probably damaging Het
Ppip5k2 A T 1: 97,759,332 C49* probably null Het
Prkrip1 T C 5: 136,197,828 N53D possibly damaging Het
Prrc2b T C 2: 32,212,298 probably benign Het
Qprt T C 7: 127,108,186 E246G probably damaging Het
Rpl9 A G 5: 65,388,652 V167A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgsm1 T C 5: 113,288,836 I43V probably benign Het
Slc38a7 A G 8: 95,840,481 probably benign Het
Slc8b1 A G 5: 120,524,200 probably benign Het
Sp2 T C 11: 96,961,699 Y133C probably damaging Het
Spdye4b A T 5: 143,195,675 D95V probably damaging Het
Srek1 T C 13: 103,743,686 T455A unknown Het
Stox2 A T 8: 47,203,282 probably benign Het
Synrg T A 11: 83,987,910 probably benign Het
Tie1 T A 4: 118,484,353 E254V probably damaging Het
Tmem97 G T 11: 78,542,588 F160L probably damaging Het
Utp6 A T 11: 79,953,631 H189Q possibly damaging Het
Vip T A 10: 5,644,953 *172R probably null Het
Wdr91 T C 6: 34,906,685 R132G possibly damaging Het
Wipi1 T C 11: 109,578,284 probably benign Het
Zfp445 A G 9: 122,852,356 V840A probably damaging Het
Other mutations in Arhgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Arhgef1 APN 7 24908359 missense possibly damaging 0.93
IGL00901:Arhgef1 APN 7 24912693 missense probably damaging 1.00
IGL01139:Arhgef1 APN 7 24925951 unclassified probably benign
IGL01479:Arhgef1 APN 7 24912603 missense probably benign 0.01
IGL01935:Arhgef1 APN 7 24921882 missense probably damaging 1.00
IGL01944:Arhgef1 APN 7 24925783 critical splice acceptor site probably null
IGL02032:Arhgef1 APN 7 24923371 missense probably benign 0.23
IGL02059:Arhgef1 APN 7 24912552 splice site probably benign
IGL02202:Arhgef1 APN 7 24913429 nonsense probably null
IGL02324:Arhgef1 APN 7 24923815 missense probably damaging 1.00
IGL02328:Arhgef1 APN 7 24923815 missense probably damaging 1.00
IGL03027:Arhgef1 APN 7 24923732 missense probably damaging 0.98
IGL03227:Arhgef1 APN 7 24922851 missense probably damaging 1.00
IGL03404:Arhgef1 APN 7 24916843 missense probably benign 0.07
R0277:Arhgef1 UTSW 7 24923799 unclassified probably benign
R0336:Arhgef1 UTSW 7 24921957 missense possibly damaging 0.77
R0494:Arhgef1 UTSW 7 24919360 intron probably benign
R0668:Arhgef1 UTSW 7 24907920 missense possibly damaging 0.63
R1520:Arhgef1 UTSW 7 24919704 missense probably damaging 1.00
R1531:Arhgef1 UTSW 7 24924998 missense probably damaging 0.99
R1656:Arhgef1 UTSW 7 24913632 missense probably damaging 1.00
R2979:Arhgef1 UTSW 7 24907751 missense unknown
R3855:Arhgef1 UTSW 7 24919272 missense probably damaging 1.00
R3856:Arhgef1 UTSW 7 24919272 missense probably damaging 1.00
R4080:Arhgef1 UTSW 7 24925846 missense probably damaging 0.96
R4081:Arhgef1 UTSW 7 24925846 missense probably damaging 0.96
R4583:Arhgef1 UTSW 7 24912571 missense probably benign 0.09
R4750:Arhgef1 UTSW 7 24918576 intron probably benign
R4914:Arhgef1 UTSW 7 24923839 missense probably damaging 1.00
R5255:Arhgef1 UTSW 7 24925022 missense probably damaging 1.00
R5275:Arhgef1 UTSW 7 24919352 critical splice donor site probably null
R5295:Arhgef1 UTSW 7 24919352 critical splice donor site probably null
R5430:Arhgef1 UTSW 7 24912307 splice site probably null
R5604:Arhgef1 UTSW 7 24912785 missense probably benign 0.09
R6150:Arhgef1 UTSW 7 24919357 splice site probably null
R6151:Arhgef1 UTSW 7 24917942 missense probably benign 0.00
R6788:Arhgef1 UTSW 7 24919780 splice site probably null
R6943:Arhgef1 UTSW 7 24923731 missense probably benign 0.01
R6988:Arhgef1 UTSW 7 24916923 missense probably benign 0.04
R7422:Arhgef1 UTSW 7 24916036 missense probably benign 0.00
R7701:Arhgef1 UTSW 7 24912578 missense probably benign 0.01
R7706:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7707:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7708:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7995:Arhgef1 UTSW 7 24919216 missense probably damaging 0.99
R8029:Arhgef1 UTSW 7 24919738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTTGGTGGTGGCAGCACAG -3'
(R):5'- AGACCCACACTGGAACTGGAATCTC -3'

Sequencing Primer
(F):5'- CAGCACAGGGAAATATTAGAATCC -3'
(R):5'- TGGAACTGGAATCTCAGTGCC -3'
Posted On2013-04-11