Incidental Mutation 'R0082:Olfr591'
ID19718
Institutional Source Beutler Lab
Gene Symbol Olfr591
Ensembl Gene ENSMUSG00000057461
Gene Nameolfactory receptor 591
SynonymsMOR24-1P, GA_x6K02T2PBJ9-5889409-5888465
MMRRC Submission 038369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0082 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103167074-103178340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 103173202 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 145 (A145E)
Ref Sequence ENSEMBL: ENSMUSP00000150894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074272] [ENSMUST00000216581]
Predicted Effect probably benign
Transcript: ENSMUST00000074272
AA Change: A145E

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073884
Gene: ENSMUSG00000057461
AA Change: A145E

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 9.4e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 255 7.1e-8 PFAM
Pfam:7tm_1 43 294 6.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216581
AA Change: A145E

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218115
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.3%
  • 10x: 91.7%
  • 20x: 73.7%
Validation Efficiency 94% (136/144)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik T C 9: 51,101,802 T57A probably benign Het
Adam17 A C 12: 21,329,048 probably benign Het
Adcy1 T C 11: 7,149,497 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ankrd33b T C 15: 31,297,789 N274S probably benign Het
Arhgef1 C T 7: 24,912,605 Q100* probably null Het
BC030499 T C 11: 78,293,558 S244P probably damaging Het
Ccdc180 A G 4: 45,896,205 D118G probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Cdh4 A T 2: 179,894,188 N844I possibly damaging Het
Cep57 T C 9: 13,810,876 probably benign Het
Dnah7a A T 1: 53,518,708 D2182E probably damaging Het
Dync1h1 A G 12: 110,636,446 T2174A probably benign Het
Eef1akmt2 T A 7: 132,851,472 R44* probably null Het
Evpl T A 11: 116,235,003 I43F probably damaging Het
F13a1 G T 13: 36,988,953 P151Q probably damaging Het
Fam173a T C 17: 25,791,574 I89V probably benign Het
Galnt5 A T 2: 57,999,035 I216F possibly damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gpr139 T A 7: 119,145,045 T106S probably benign Het
Hoxb3 A G 11: 96,344,271 D8G probably damaging Het
Hpse T C 5: 100,692,262 K330E possibly damaging Het
Kcmf1 G T 6: 72,850,487 probably null Het
Klra2 T C 6: 131,220,247 N263S possibly damaging Het
Klra8 T C 6: 130,125,055 D139G probably benign Het
Lrrc46 A C 11: 97,041,077 probably benign Het
Ly86 A T 13: 37,418,537 probably null Het
Mmp20 C T 9: 7,642,807 T214M probably benign Het
Olfr729 A T 14: 50,148,055 I273K probably damaging Het
Olfr786 T C 10: 129,437,271 I153T possibly damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Pigg A G 5: 108,312,885 probably benign Het
Polq C A 16: 37,017,257 T177K probably benign Het
Pomgnt2 A T 9: 121,982,260 V485E probably damaging Het
Ppip5k2 A T 1: 97,759,332 C49* probably null Het
Prkrip1 T C 5: 136,197,828 N53D possibly damaging Het
Prrc2b T C 2: 32,212,298 probably benign Het
Qprt T C 7: 127,108,186 E246G probably damaging Het
Rpl9 A G 5: 65,388,652 V167A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgsm1 T C 5: 113,288,836 I43V probably benign Het
Slc38a7 A G 8: 95,840,481 probably benign Het
Slc8b1 A G 5: 120,524,200 probably benign Het
Sp2 T C 11: 96,961,699 Y133C probably damaging Het
Spdye4b A T 5: 143,195,675 D95V probably damaging Het
Srek1 T C 13: 103,743,686 T455A unknown Het
Stox2 A T 8: 47,203,282 probably benign Het
Synrg T A 11: 83,987,910 probably benign Het
Tie1 T A 4: 118,484,353 E254V probably damaging Het
Tmem97 G T 11: 78,542,588 F160L probably damaging Het
Utp6 A T 11: 79,953,631 H189Q possibly damaging Het
Vip T A 10: 5,644,953 *172R probably null Het
Wdr91 T C 6: 34,906,685 R132G possibly damaging Het
Wipi1 T C 11: 109,578,284 probably benign Het
Zfp445 A G 9: 122,852,356 V840A probably damaging Het
Other mutations in Olfr591
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02408:Olfr591 APN 7 103173451 missense probably damaging 1.00
IGL03307:Olfr591 APN 7 103173416 missense probably benign 0.00
R0389:Olfr591 UTSW 7 103173283 missense possibly damaging 0.48
R0843:Olfr591 UTSW 7 103173119 missense possibly damaging 0.74
R1378:Olfr591 UTSW 7 103173268 missense probably damaging 1.00
R1386:Olfr591 UTSW 7 103173367 missense probably benign 0.11
R1521:Olfr591 UTSW 7 103173451 missense probably benign 0.39
R1538:Olfr591 UTSW 7 103172986 missense probably damaging 0.97
R3108:Olfr591 UTSW 7 103173086 missense probably damaging 0.98
R3109:Olfr591 UTSW 7 103173086 missense probably damaging 0.98
R5350:Olfr591 UTSW 7 103173559 missense probably damaging 0.99
R5488:Olfr591 UTSW 7 103173451 missense probably damaging 1.00
R5489:Olfr591 UTSW 7 103173451 missense probably damaging 1.00
R5598:Olfr591 UTSW 7 103173634 start codon destroyed probably null 1.00
R5607:Olfr591 UTSW 7 103172849 missense probably damaging 0.96
R5608:Olfr591 UTSW 7 103172849 missense probably damaging 0.96
R6974:Olfr591 UTSW 7 103173235 missense probably damaging 0.99
R6994:Olfr591 UTSW 7 103172912 missense probably damaging 1.00
R7095:Olfr591 UTSW 7 103173046 missense probably benign 0.00
Z1088:Olfr591 UTSW 7 103172806 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCCACTTTGTGCCCAAACCTATG -3'
(R):5'- TGGTTTCACGATGGAGAGATTCGC -3'

Sequencing Primer
(F):5'- CCAGAGTCTTGAGTCTGGCATC -3'
(R):5'- TCGCTTTGAAGCTTGCCT -3'
Posted On2013-04-11