Incidental Mutation 'R1777:Tmem132a'
List |< first << previous [record 81 of 92] next >> last >|
Institutional Source Beutler Lab
Gene Symbol Tmem132a
Ensembl Gene ENSMUSG00000024736
Gene Nametransmembrane protein 132A
SynonymsHspa5bp1, 6720481D13Rik
MMRRC Submission 039808-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1777 (G1)
Quality Score225
Status Not validated
Chromosomal Location10857822-10869940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10858506 bp
Amino Acid Change Histidine to Tyrosine at position 887 (H887Y)
Ref Sequence ENSEMBL: ENSMUSP00000025645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025645] [ENSMUST00000025646] [ENSMUST00000120524]
Predicted Effect probably damaging
Transcript: ENSMUST00000025645
AA Change: H887Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025645
Gene: ENSMUSG00000024736
AA Change: H887Y

signal peptide 1 32 N/A INTRINSIC
Pfam:TMEM132D_N 44 167 1.6e-35 PFAM
low complexity region 206 223 N/A INTRINSIC
Pfam:TMEM132 403 745 4.1e-108 PFAM
low complexity region 759 776 N/A INTRINSIC
Pfam:TMEM132D_C 809 897 1.5e-31 PFAM
low complexity region 906 923 N/A INTRINSIC
low complexity region 932 944 N/A INTRINSIC
low complexity region 960 976 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025646
SMART Domains Protein: ENSMUSP00000025646
Gene: ENSMUSG00000024737

low complexity region 21 37 N/A INTRINSIC
Pfam:MFS_1 38 508 3.4e-10 PFAM
Pfam:PTR2 101 519 3.2e-79 PFAM
transmembrane domain 538 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120524
SMART Domains Protein: ENSMUSP00000113696
Gene: ENSMUSG00000024736

signal peptide 1 32 N/A INTRINSIC
low complexity region 206 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138263
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to the rat Grp78-binding protein (GBP). Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik T A 1: 16,078,589 D111V possibly damaging Het
Ap2a1 G A 7: 44,904,152 T597M probably damaging Het
Arhgap25 A G 6: 87,463,307 S364P probably benign Het
Atp6v1a G T 16: 44,114,705 Y40* probably null Het
Cdh1 T A 8: 106,656,835 H235Q probably damaging Het
Cntln A G 4: 85,130,679 E1376G probably benign Het
Cntnap5b T A 1: 100,370,078 S781T probably benign Het
Cpne4 A G 9: 104,872,688 T64A probably damaging Het
Ctsg T C 14: 56,100,601 Y179C probably damaging Het
Cx3cr1 A G 9: 120,051,593 Y248H probably damaging Het
Dhx37 T C 5: 125,429,931 E167G probably benign Het
Dnajc21 C A 15: 10,449,607 A443S probably benign Het
Drd5 T C 5: 38,320,161 S166P probably damaging Het
Dscaml1 T C 9: 45,683,756 L719P possibly damaging Het
Eif2ak4 T C 2: 118,430,839 I542T probably damaging Het
Ephb3 G A 16: 21,217,235 G291E probably damaging Het
Eva1a T A 6: 82,092,156 Y155N probably damaging Het
Exog C T 9: 119,449,818 P189L probably damaging Het
Fam13b A G 18: 34,457,760 V455A possibly damaging Het
Fam192a T C 8: 94,588,811 E31G probably damaging Het
Fam35a C A 14: 34,268,173 V259L probably benign Het
Fmn2 C A 1: 174,581,922 Q574K unknown Het
Gm10037 A T 13: 67,833,865 R65S probably benign Het
Gm6871 A T 7: 41,545,719 S531R probably benign Het
Golga2 T A 2: 32,305,470 probably null Het
Hydin C T 8: 110,589,571 P4365L probably benign Het
Ints8 A T 4: 11,225,600 probably null Het
Kbtbd12 A C 6: 88,618,060 S263A probably benign Het
Kcng4 T C 8: 119,633,487 D50G probably benign Het
Klhl18 A T 9: 110,437,401 C217S probably benign Het
Klk1b4 A G 7: 44,207,451 probably benign Het
Klk7 G A 7: 43,813,329 C186Y probably damaging Het
Krit1 T C 5: 3,836,799 Y635H probably damaging Het
Lipo4 A T 19: 33,499,321 D342E probably damaging Het
Lsm14b T G 2: 180,031,795 D199E probably benign Het
Map3k4 A T 17: 12,271,730 N271K possibly damaging Het
Mast1 T A 8: 84,912,068 N1544I probably benign Het
Megf6 T A 4: 154,270,690 C1487* probably null Het
Mlh3 C A 12: 85,268,754 K219N possibly damaging Het
Mtmr4 A G 11: 87,602,830 K305E probably damaging Het
Myo15 A G 11: 60,514,936 M3105V probably benign Het
Nbas A T 12: 13,513,562 I1958F probably benign Het
Nepro A T 16: 44,735,853 Q458L probably damaging Het
Olfr1309 T A 2: 111,983,697 I126L possibly damaging Het
Olfr198 A G 16: 59,202,016 S137P probably benign Het
Olfr295 T A 7: 86,586,064 I263N probably benign Het
Olfr583 T C 7: 103,051,376 I26T probably benign Het
Olfr741 T A 14: 50,486,300 F281I probably benign Het
Olfr874 A G 9: 37,746,311 Y59C possibly damaging Het
Opa3 T C 7: 19,244,912 Y101H probably damaging Het
Pate3 T C 9: 35,648,116 N2D probably benign Het
Pcdhb21 T A 18: 37,515,718 D633E possibly damaging Het
Pgm1 C T 5: 64,127,782 P589L probably benign Het
Pigg T A 5: 108,317,391 D163E probably damaging Het
Polq A G 16: 37,060,224 T638A possibly damaging Het
Prmt3 T A 7: 49,798,346 M268K possibly damaging Het
Prmt9 T C 8: 77,565,108 C370R probably benign Het
Prss57 A T 10: 79,787,385 V76E possibly damaging Het
Pzp T C 6: 128,490,572 E1089G possibly damaging Het
Qars T A 9: 108,508,201 probably null Het
Ralgapb T C 2: 158,462,195 Y625H probably damaging Het
Rgl2 G A 17: 33,931,744 D59N probably benign Het
Robo1 T G 16: 73,004,667 W1060G probably benign Het
Scaper A T 9: 55,864,546 V362E probably benign Het
Schip1 T C 3: 68,617,684 F131S probably damaging Het
Sh2b2 A T 5: 136,227,422 V252D probably damaging Het
Slc17a6 A T 7: 51,646,209 H199L possibly damaging Het
Slc29a1 A G 17: 45,587,308 Y325H probably damaging Het
Slc29a4 G T 5: 142,714,062 W156L probably damaging Het
Slc5a3 T A 16: 92,077,756 S234T probably benign Het
Srd5a3 T G 5: 76,149,783 V20G probably damaging Het
Stac A T 9: 111,604,082 S223T possibly damaging Het
Sytl2 A T 7: 90,403,052 T766S probably benign Het
Tas2r102 A G 6: 132,762,291 D54G probably benign Het
Tbpl1 A G 10: 22,707,843 V105A probably damaging Het
Tenm3 G T 8: 48,417,179 P193Q probably benign Het
Tes G A 6: 17,104,755 V403M probably benign Het
Tgfbr2 A C 9: 116,109,880 I318S probably damaging Het
Tgfbr3 C A 5: 107,136,930 V618L probably benign Het
Tmc1 C T 19: 20,816,109 probably null Het
Tmem43 C A 6: 91,477,330 S33* probably null Het
Tob1 A G 11: 94,213,754 K39E probably damaging Het
Unc79 T A 12: 103,112,455 D1433E probably damaging Het
Usp25 T C 16: 77,081,554 M622T probably damaging Het
Vmn1r158 A T 7: 22,790,430 L118Q probably damaging Het
Vmn1r217 T A 13: 23,114,325 I136L probably benign Het
Vmn2r15 A T 5: 109,294,270 I99K possibly damaging Het
Vwa7 T A 17: 35,024,948 V786E probably damaging Het
Xkr5 A G 8: 18,939,132 F248S probably benign Het
Zcchc6 A T 13: 59,791,821 H705Q probably damaging Het
Zzef1 A T 11: 72,910,272 K2444M probably damaging Het
Other mutations in Tmem132a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Tmem132a APN 19 10861524 splice site probably benign
IGL02508:Tmem132a APN 19 10858518 missense probably damaging 1.00
R0514:Tmem132a UTSW 19 10858991 missense probably damaging 0.99
R0918:Tmem132a UTSW 19 10858113 missense probably damaging 1.00
R1160:Tmem132a UTSW 19 10858574 missense probably damaging 0.98
R1205:Tmem132a UTSW 19 10859084 missense probably benign 0.03
R1619:Tmem132a UTSW 19 10861698 missense probably damaging 1.00
R1815:Tmem132a UTSW 19 10861567 nonsense probably null
R1869:Tmem132a UTSW 19 10858688 missense possibly damaging 0.48
R1888:Tmem132a UTSW 19 10863499 missense probably damaging 1.00
R1888:Tmem132a UTSW 19 10863499 missense probably damaging 1.00
R2133:Tmem132a UTSW 19 10864066 missense probably benign 0.26
R2441:Tmem132a UTSW 19 10860137 missense probably damaging 0.96
R2570:Tmem132a UTSW 19 10859742 missense probably null 1.00
R3157:Tmem132a UTSW 19 10859537 nonsense probably null
R3159:Tmem132a UTSW 19 10859537 nonsense probably null
R4152:Tmem132a UTSW 19 10859063 missense probably benign 0.04
R4281:Tmem132a UTSW 19 10861726 missense possibly damaging 0.81
R4547:Tmem132a UTSW 19 10860200 missense possibly damaging 0.83
R4793:Tmem132a UTSW 19 10865493 missense probably damaging 1.00
R4947:Tmem132a UTSW 19 10866934 missense possibly damaging 0.90
R4998:Tmem132a UTSW 19 10858941 missense probably benign 0.02
R5226:Tmem132a UTSW 19 10867144 missense possibly damaging 0.50
R5323:Tmem132a UTSW 19 10864007 missense possibly damaging 0.81
R6659:Tmem132a UTSW 19 10860321 missense probably damaging 0.99
R6814:Tmem132a UTSW 19 10863305 missense probably damaging 1.00
R6872:Tmem132a UTSW 19 10863305 missense probably damaging 1.00
R7205:Tmem132a UTSW 19 10866931 missense probably damaging 1.00
R7383:Tmem132a UTSW 19 10866994 missense probably benign 0.01
R7505:Tmem132a UTSW 19 10858673 missense probably damaging 1.00
R7513:Tmem132a UTSW 19 10860128 missense probably damaging 0.98
R7595:Tmem132a UTSW 19 10858205 missense probably damaging 1.00
Z1088:Tmem132a UTSW 19 10858935 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gaagaggaggaagatgaggaag -3'
Posted On2014-05-23