Incidental Mutation 'R1778:Baz2b'
ID 197195
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Name bromodomain adjacent to zinc finger domain, 2B
Synonyms D2Ertd794e, 5830435C13Rik
MMRRC Submission 039809-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.287) question?
Stock # R1778 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 59729707-60040183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59836480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 18 (T18A)
Ref Sequence ENSEMBL: ENSMUSP00000108169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
AlphaFold A2AUY4
Predicted Effect unknown
Transcript: ENSMUST00000090925
AA Change: T18A
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: T18A

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect unknown
Transcript: ENSMUST00000112550
AA Change: T18A
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: T18A

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153711
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T C 7: 29,260,131 (GRCm39) noncoding transcript Het
4930568D16Rik A G 2: 35,244,995 (GRCm39) M119T probably damaging Het
Aadacl2 A G 3: 59,924,871 (GRCm39) probably null Het
Abca9 C T 11: 110,021,542 (GRCm39) W1056* probably null Het
Adam20 A C 8: 41,249,698 (GRCm39) T603P possibly damaging Het
Adgrl1 T C 8: 84,656,666 (GRCm39) L323P probably damaging Het
Afap1l2 C T 19: 56,904,638 (GRCm39) E628K possibly damaging Het
Ahctf1 A T 1: 179,580,580 (GRCm39) L1874Q possibly damaging Het
Ak8 A G 2: 28,602,333 (GRCm39) E89G probably benign Het
Aldh16a1 G A 7: 44,796,732 (GRCm39) R256C probably damaging Het
Anxa5 G A 3: 36,519,480 (GRCm39) T3M probably damaging Het
Arhgef16 T C 4: 154,372,443 (GRCm39) K210E probably benign Het
Bub1 A C 2: 127,645,042 (GRCm39) I960M possibly damaging Het
Cbln2 G T 18: 86,731,272 (GRCm39) D27Y probably benign Het
Ces2h C A 8: 105,741,239 (GRCm39) P77Q possibly damaging Het
Cfap410 G T 10: 77,818,778 (GRCm39) A150S probably benign Het
Chga T A 12: 102,527,959 (GRCm39) M150K probably benign Het
Chmp3 A G 6: 71,554,791 (GRCm39) E162G probably benign Het
Clip3 A G 7: 29,996,861 (GRCm39) N161S probably damaging Het
Col12a1 T A 9: 79,511,867 (GRCm39) probably benign Het
Cuedc2 C T 19: 46,320,079 (GRCm39) G105D probably benign Het
Cyp2j7 A C 4: 96,087,627 (GRCm39) F428V probably damaging Het
Ddx60 A G 8: 62,427,210 (GRCm39) I762V possibly damaging Het
Def6 G A 17: 28,439,160 (GRCm39) R257Q probably benign Het
Dkkl1 A T 7: 44,860,819 (GRCm39) probably null Het
Dnah3 A G 7: 119,677,625 (GRCm39) L433P probably damaging Het
Eif2s3y C T Y: 1,011,287 (GRCm39) R33C probably benign Het
Elavl2 T A 4: 91,141,715 (GRCm39) Y269F probably damaging Het
Esco2 A G 14: 66,068,711 (GRCm39) S200P possibly damaging Het
Fcrl1 T A 3: 87,292,626 (GRCm39) probably benign Het
Fhod1 C A 8: 106,056,309 (GRCm39) D1135Y probably damaging Het
Fnbp1l T C 3: 122,383,796 (GRCm39) N41D possibly damaging Het
Folh1 A T 7: 86,410,907 (GRCm39) probably null Het
Fpr-rs7 T C 17: 20,334,277 (GRCm39) D71G probably damaging Het
Gm10271 A G 10: 116,797,844 (GRCm39) probably benign Het
Gm4841 A T 18: 60,404,020 (GRCm39) Y24* probably null Het
Greb1 G A 12: 16,740,895 (GRCm39) R1396C probably benign Het
Hectd1 C T 12: 51,800,590 (GRCm39) C2076Y probably damaging Het
Hnrnpu A G 1: 178,152,806 (GRCm39) probably benign Het
Ice2 T C 9: 69,322,930 (GRCm39) I475T probably benign Het
Ifit1bl1 T A 19: 34,571,593 (GRCm39) Q288L probably damaging Het
Ift56 T A 6: 38,386,411 (GRCm39) D377E possibly damaging Het
Ik T C 18: 36,889,871 (GRCm39) probably benign Het
Kidins220 C T 12: 25,063,445 (GRCm39) probably benign Het
Kmt2c T C 5: 25,577,972 (GRCm39) D768G probably benign Het
Kmt2e A G 5: 23,697,362 (GRCm39) T87A probably damaging Het
Lama5 G A 2: 179,837,274 (GRCm39) probably benign Het
Lmbr1l A G 15: 98,810,357 (GRCm39) S85P probably damaging Het
Lrig2 A G 3: 104,374,682 (GRCm39) probably benign Het
Lrig3 A G 10: 125,845,944 (GRCm39) D791G probably damaging Het
Lrrc2 G A 9: 110,809,908 (GRCm39) V315M probably benign Het
Lrrc4b A G 7: 44,111,823 (GRCm39) D565G probably benign Het
Mpped1 C T 15: 83,676,191 (GRCm39) probably benign Het
Msrb2 T A 2: 19,388,114 (GRCm39) D87E probably benign Het
Muc20 T C 16: 32,614,511 (GRCm39) T289A possibly damaging Het
Myo15a C A 11: 60,369,238 (GRCm39) P666Q possibly damaging Het
Nfat5 C T 8: 108,088,421 (GRCm39) P579L probably damaging Het
Nipbl A C 15: 8,348,972 (GRCm39) M1920R probably damaging Het
Nuak1 T C 10: 84,210,738 (GRCm39) probably null Het
Nup210l A G 3: 90,096,793 (GRCm39) E1334G probably damaging Het
Odad2 A T 18: 7,127,388 (GRCm39) C942S probably damaging Het
Or52e8b A T 7: 104,673,370 (GRCm39) N272K probably benign Het
Or5an1c T A 19: 12,218,819 (GRCm39) I69F probably benign Het
Or6c6c T C 10: 129,541,574 (GRCm39) Y276H probably benign Het
Or9s13 G A 1: 92,548,342 (GRCm39) G238E possibly damaging Het
Or9s14 A T 1: 92,535,831 (GRCm39) N91Y possibly damaging Het
P4ha3 A T 7: 99,949,898 (GRCm39) probably null Het
Pbld2 C T 10: 62,890,150 (GRCm39) A186V probably benign Het
Pcdh18 A T 3: 49,710,083 (GRCm39) Y411N probably benign Het
Pgf A G 12: 85,218,541 (GRCm39) S70P probably benign Het
Phrf1 T A 7: 140,812,369 (GRCm39) D44E probably benign Het
Pla2g4a A G 1: 149,778,196 (GRCm39) probably benign Het
Plce1 A G 19: 38,769,234 (GRCm39) probably benign Het
Plxna2 A G 1: 194,493,278 (GRCm39) N1851S probably benign Het
Prl7a2 G A 13: 27,843,254 (GRCm39) T183I probably damaging Het
Prxl2b A T 4: 154,981,814 (GRCm39) V151D probably damaging Het
Ptger4 A T 15: 5,264,576 (GRCm39) L335H probably damaging Het
Ptgr1 A G 4: 58,984,865 (GRCm39) probably benign Het
Rdh7 A G 10: 127,720,590 (GRCm39) S261P probably benign Het
Reg3a A G 6: 78,360,269 (GRCm39) T150A probably benign Het
Rnf111 A G 9: 70,383,394 (GRCm39) S180P probably benign Het
Rnf17 A G 14: 56,759,856 (GRCm39) M1554V probably damaging Het
Rnf215 T A 11: 4,085,873 (GRCm39) Y117* probably null Het
Rnps1-ps A T 6: 7,983,124 (GRCm39) noncoding transcript Het
Rogdi T C 16: 4,828,369 (GRCm39) T165A probably benign Het
Rpe65 A G 3: 159,328,485 (GRCm39) Y431C probably damaging Het
Scube1 A G 15: 83,494,405 (GRCm39) F844S probably damaging Het
Sdr16c6 T A 4: 4,058,814 (GRCm39) E257D probably benign Het
Sim1 C A 10: 50,857,649 (GRCm39) C466* probably null Het
Spi1 T A 2: 90,929,867 (GRCm39) H46Q probably damaging Het
Sumf2 C A 5: 129,873,909 (GRCm39) probably benign Het
Tbcb A G 7: 29,931,037 (GRCm39) Y28H probably benign Het
Tecta C T 9: 42,254,927 (GRCm39) C1752Y probably damaging Het
Tep1 T C 14: 51,067,079 (GRCm39) probably benign Het
Tmem245 A T 4: 56,903,968 (GRCm39) W591R probably damaging Het
Tnxb A G 17: 34,902,548 (GRCm39) I1134V probably benign Het
Trappc14 T C 5: 138,260,739 (GRCm39) probably null Het
Trim13 G T 14: 61,843,068 (GRCm39) A362S probably benign Het
Trim47 T A 11: 116,000,646 (GRCm39) D134V probably damaging Het
Utrn C A 10: 12,312,108 (GRCm39) D616Y probably damaging Het
Vnn1 G T 10: 23,775,415 (GRCm39) A222S possibly damaging Het
Wdr17 A G 8: 55,143,249 (GRCm39) W110R probably damaging Het
Wwp1 G T 4: 19,627,892 (GRCm39) Y700* probably null Het
Zbtb21 T C 16: 97,751,785 (GRCm39) S661G probably benign Het
Zfp955b A G 17: 33,521,788 (GRCm39) K419R probably benign Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59,743,139 (GRCm39) missense probably benign 0.02
IGL00476:Baz2b APN 2 59,744,083 (GRCm39) missense probably benign 0.06
IGL00489:Baz2b APN 2 59,788,019 (GRCm39) nonsense probably null
IGL00514:Baz2b APN 2 59,792,821 (GRCm39) missense probably benign 0.11
IGL00678:Baz2b APN 2 59,836,527 (GRCm39) missense unknown
IGL01348:Baz2b APN 2 59,764,031 (GRCm39) missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59,799,233 (GRCm39) missense probably benign 0.18
IGL01924:Baz2b APN 2 59,765,615 (GRCm39) missense probably damaging 1.00
IGL02125:Baz2b APN 2 59,798,984 (GRCm39) missense probably benign 0.12
IGL02314:Baz2b APN 2 59,792,571 (GRCm39) missense probably benign
IGL02370:Baz2b APN 2 59,753,933 (GRCm39) missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59,790,407 (GRCm39) missense probably benign 0.40
IGL02499:Baz2b APN 2 59,731,840 (GRCm39) missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59,747,713 (GRCm39) missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59,778,604 (GRCm39) missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59,747,849 (GRCm39) unclassified probably benign
IGL02716:Baz2b APN 2 59,792,868 (GRCm39) missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59,807,718 (GRCm39) missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59,799,002 (GRCm39) missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59,807,872 (GRCm39) missense probably benign 0.00
IGL02886:Baz2b APN 2 59,788,087 (GRCm39) splice site probably null
IGL02892:Baz2b APN 2 59,731,080 (GRCm39) missense probably damaging 1.00
IGL03132:Baz2b APN 2 59,738,097 (GRCm39) splice site probably benign
IGL03183:Baz2b APN 2 59,733,640 (GRCm39) missense probably benign 0.10
IGL03197:Baz2b APN 2 59,731,898 (GRCm39) missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59,762,510 (GRCm39) missense probably damaging 1.00
R0054:Baz2b UTSW 2 59,762,510 (GRCm39) missense probably damaging 1.00
R0122:Baz2b UTSW 2 59,743,963 (GRCm39) splice site probably null
R0136:Baz2b UTSW 2 59,732,298 (GRCm39) missense probably benign 0.22
R0144:Baz2b UTSW 2 59,737,839 (GRCm39) missense probably damaging 0.98
R0403:Baz2b UTSW 2 59,799,721 (GRCm39) missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59,732,340 (GRCm39) unclassified probably benign
R0528:Baz2b UTSW 2 59,767,083 (GRCm39) missense probably damaging 1.00
R1025:Baz2b UTSW 2 59,792,826 (GRCm39) missense probably benign 0.06
R1470:Baz2b UTSW 2 59,808,890 (GRCm39) missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59,808,890 (GRCm39) missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59,752,553 (GRCm39) missense probably damaging 1.00
R1511:Baz2b UTSW 2 59,792,368 (GRCm39) missense probably benign 0.12
R1514:Baz2b UTSW 2 59,792,670 (GRCm39) missense probably benign 0.13
R1519:Baz2b UTSW 2 59,778,598 (GRCm39) missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59,798,981 (GRCm39) missense possibly damaging 0.47
R1630:Baz2b UTSW 2 59,836,474 (GRCm39) missense unknown
R1641:Baz2b UTSW 2 59,743,234 (GRCm39) missense probably damaging 0.99
R1674:Baz2b UTSW 2 59,743,336 (GRCm39) missense possibly damaging 0.53
R1826:Baz2b UTSW 2 59,799,077 (GRCm39) missense probably benign 0.12
R1835:Baz2b UTSW 2 59,732,163 (GRCm39) missense probably benign 0.02
R1954:Baz2b UTSW 2 59,799,087 (GRCm39) missense probably benign 0.12
R1981:Baz2b UTSW 2 59,754,024 (GRCm39) missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59,743,067 (GRCm39) unclassified probably benign
R2567:Baz2b UTSW 2 59,744,255 (GRCm39) missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59,743,348 (GRCm39) missense probably benign 0.27
R2848:Baz2b UTSW 2 59,755,010 (GRCm39) missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59,799,240 (GRCm39) missense probably benign 0.12
R3935:Baz2b UTSW 2 59,743,105 (GRCm39) missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59,743,105 (GRCm39) missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59,742,917 (GRCm39) splice site probably null
R4182:Baz2b UTSW 2 59,928,801 (GRCm39) intron probably benign
R4255:Baz2b UTSW 2 59,750,916 (GRCm39) unclassified probably benign
R4359:Baz2b UTSW 2 59,731,957 (GRCm39) missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59,799,599 (GRCm39) missense probably benign 0.06
R4743:Baz2b UTSW 2 59,744,255 (GRCm39) missense probably benign 0.01
R4772:Baz2b UTSW 2 59,788,795 (GRCm39) missense probably damaging 0.96
R4858:Baz2b UTSW 2 59,738,087 (GRCm39) missense probably benign
R4868:Baz2b UTSW 2 59,755,226 (GRCm39) missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59,773,103 (GRCm39) splice site probably null
R4889:Baz2b UTSW 2 59,767,070 (GRCm39) missense probably damaging 1.00
R4890:Baz2b UTSW 2 59,756,383 (GRCm39) missense probably damaging 0.99
R4914:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R5027:Baz2b UTSW 2 59,928,988 (GRCm39) intron probably benign
R5031:Baz2b UTSW 2 59,743,151 (GRCm39) missense probably benign 0.00
R5082:Baz2b UTSW 2 59,731,835 (GRCm39) nonsense probably null
R5133:Baz2b UTSW 2 59,792,368 (GRCm39) missense probably benign 0.12
R5276:Baz2b UTSW 2 59,792,958 (GRCm39) missense probably benign 0.40
R5279:Baz2b UTSW 2 59,762,496 (GRCm39) missense probably damaging 1.00
R5294:Baz2b UTSW 2 59,808,946 (GRCm39) missense probably benign 0.11
R5447:Baz2b UTSW 2 59,744,332 (GRCm39) missense probably damaging 0.99
R5903:Baz2b UTSW 2 59,790,233 (GRCm39) missense probably damaging 0.99
R5910:Baz2b UTSW 2 59,807,770 (GRCm39) missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59,742,871 (GRCm39) missense probably damaging 0.99
R6195:Baz2b UTSW 2 59,737,855 (GRCm39) missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59,809,019 (GRCm39) missense probably benign 0.00
R6208:Baz2b UTSW 2 59,755,150 (GRCm39) missense probably damaging 1.00
R6233:Baz2b UTSW 2 59,737,855 (GRCm39) missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59,778,567 (GRCm39) missense probably damaging 1.00
R6324:Baz2b UTSW 2 59,737,292 (GRCm39) missense probably damaging 1.00
R6490:Baz2b UTSW 2 59,732,073 (GRCm39) missense probably damaging 1.00
R6578:Baz2b UTSW 2 59,799,623 (GRCm39) missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59,755,234 (GRCm39) missense probably damaging 1.00
R6760:Baz2b UTSW 2 59,792,776 (GRCm39) missense probably benign 0.40
R6836:Baz2b UTSW 2 59,747,769 (GRCm39) missense probably damaging 1.00
R6859:Baz2b UTSW 2 59,731,874 (GRCm39) missense probably benign 0.01
R6880:Baz2b UTSW 2 59,743,283 (GRCm39) missense probably damaging 0.99
R6916:Baz2b UTSW 2 59,799,120 (GRCm39) missense probably benign
R6978:Baz2b UTSW 2 59,738,059 (GRCm39) missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59,764,014 (GRCm39) critical splice donor site probably null
R7112:Baz2b UTSW 2 59,792,528 (GRCm39) missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59,742,841 (GRCm39) missense
R7198:Baz2b UTSW 2 59,792,550 (GRCm39) missense probably benign 0.00
R7270:Baz2b UTSW 2 59,792,836 (GRCm39) missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59,750,781 (GRCm39) missense probably benign 0.17
R7464:Baz2b UTSW 2 59,807,792 (GRCm39) missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59,792,817 (GRCm39) missense probably benign 0.40
R7703:Baz2b UTSW 2 59,747,769 (GRCm39) missense probably damaging 1.00
R7850:Baz2b UTSW 2 59,767,060 (GRCm39) missense probably damaging 0.98
R7851:Baz2b UTSW 2 59,767,060 (GRCm39) missense probably damaging 0.98
R7988:Baz2b UTSW 2 59,792,485 (GRCm39) missense possibly damaging 0.53
R8079:Baz2b UTSW 2 59,731,112 (GRCm39) missense probably damaging 1.00
R8084:Baz2b UTSW 2 59,792,580 (GRCm39) missense probably benign
R8343:Baz2b UTSW 2 59,731,858 (GRCm39) missense probably damaging 1.00
R8348:Baz2b UTSW 2 59,742,137 (GRCm39) missense
R8438:Baz2b UTSW 2 59,747,828 (GRCm39) nonsense probably null
R8448:Baz2b UTSW 2 59,742,137 (GRCm39) missense
R8511:Baz2b UTSW 2 59,732,158 (GRCm39) missense probably benign
R8893:Baz2b UTSW 2 59,755,149 (GRCm39) missense probably damaging 0.96
R8947:Baz2b UTSW 2 59,778,583 (GRCm39) missense probably benign 0.06
R8998:Baz2b UTSW 2 59,799,608 (GRCm39) missense probably benign 0.02
R9241:Baz2b UTSW 2 59,743,993 (GRCm39) missense probably benign 0.01
R9245:Baz2b UTSW 2 59,743,331 (GRCm39) missense probably benign
R9577:Baz2b UTSW 2 59,809,031 (GRCm39) missense probably benign 0.06
R9581:Baz2b UTSW 2 59,799,300 (GRCm39) missense probably benign
R9601:Baz2b UTSW 2 59,731,847 (GRCm39) missense possibly damaging 0.66
R9613:Baz2b UTSW 2 59,731,824 (GRCm39) missense probably benign 0.09
R9639:Baz2b UTSW 2 59,731,828 (GRCm39) missense probably benign 0.01
X0011:Baz2b UTSW 2 59,807,705 (GRCm39) missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59,731,019 (GRCm39) missense probably damaging 1.00
X0064:Baz2b UTSW 2 59,799,626 (GRCm39) missense probably benign
Z1088:Baz2b UTSW 2 59,790,359 (GRCm39) missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59,807,864 (GRCm39) missense probably benign 0.01
Z1188:Baz2b UTSW 2 59,807,749 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTAGACTCTCAGGGAAGGGTTACGG -3'
(R):5'- TCCTCCTCTCACATTGAGGACTTAAGC -3'

Sequencing Primer
(F):5'- CTGAGTAATCAGGACTCTGCCAG -3'
(R):5'- TCACATTGAGGACTTAAGCCTGAG -3'
Posted On 2014-05-23