Mutagenetix > Incidental Mutation

Incidental Mutation 'R1778:Rpe65'

197210

Institutional Source

Beutler Lab

Gene Symbol

Rpe65

Ensembl Gene

ENSMUSG00000028174

Gene Name

retinal pigment epithelium 65

Synonyms

A930029L06Rik, Mord1, rd12

MMRRC Submission

039809-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.230) question?

Stock #

R1778 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

159599175-159625321 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 159622848 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 431 (Y431C)

Ref Sequence

ENSEMBL: ENSMUSP00000143654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]

AlphaFold

Q91ZQ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000029824
AA Change: Y431C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: Y431C

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000196999
AA Change: Y431C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: Y431C

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Meta Mutation Damage Score

0.9606

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.3%

Validation Efficiency

98% (107/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	G	T	10: 77,982,944	A150S	probably benign	Het
4930432E11Rik	T	C	7: 29,560,706		noncoding transcript	Het
4930568D16Rik	A	G	2: 35,354,983	M119T	probably damaging	Het
Aadacl2	A	G	3: 60,017,450		probably null	Het
Abca9	C	T	11: 110,130,716	W1056*	probably null	Het
Adam20	A	C	8: 40,796,661	T603P	possibly damaging	Het
Adgrl1	T	C	8: 83,930,037	L323P	probably damaging	Het
Afap1l2	C	T	19: 56,916,206	E628K	possibly damaging	Het
Ahctf1	A	T	1: 179,753,015	L1874Q	possibly damaging	Het
Ak8	A	G	2: 28,712,321	E89G	probably benign	Het
Aldh16a1	G	A	7: 45,147,308	R256C	probably damaging	Het
Anxa5	G	A	3: 36,465,331	T3M	probably damaging	Het
Arhgef16	T	C	4: 154,287,986	K210E	probably benign	Het
Armc4	A	T	18: 7,127,388	C942S	probably damaging	Het
Baz2b	T	C	2: 60,006,136	T18A	unknown	Het
BC037034	T	C	5: 138,262,477		probably null	Het
Bub1	A	C	2: 127,803,122	I960M	possibly damaging	Het
Cbln2	G	T	18: 86,713,147	D27Y	probably benign	Het
Ces2h	C	A	8: 105,014,607	P77Q	possibly damaging	Het
Chga	T	A	12: 102,561,700	M150K	probably benign	Het
Chmp3	A	G	6: 71,577,807	E162G	probably benign	Het
Clip3	A	G	7: 30,297,436	N161S	probably damaging	Het
Col12a1	T	A	9: 79,604,585		probably benign	Het
Cuedc2	C	T	19: 46,331,640	G105D	probably benign	Het
Cyp2j7	A	C	4: 96,199,390	F428V	probably damaging	Het
Ddx60	A	G	8: 61,974,176	I762V	possibly damaging	Het
Def6	G	A	17: 28,220,186	R257Q	probably benign	Het
Dkkl1	A	T	7: 45,211,395		probably null	Het
Dnah3	A	G	7: 120,078,402	L433P	probably damaging	Het
Eif2s3y	C	T	Y: 1,011,287	R33C	probably benign	Het
Elavl2	T	A	4: 91,253,478	Y269F	probably damaging	Het
Esco2	A	G	14: 65,831,262	S200P	possibly damaging	Het
Fam213b	A	T	4: 154,897,357	V151D	probably damaging	Het
Fcrl1	T	A	3: 87,385,319		probably benign	Het
Fhod1	C	A	8: 105,329,677	D1135Y	probably damaging	Het
Fnbp1l	T	C	3: 122,590,147	N41D	possibly damaging	Het
Folh1	A	T	7: 86,761,699		probably null	Het
Fpr-rs7	T	C	17: 20,114,015	D71G	probably damaging	Het
Gm10271	A	G	10: 116,961,939		probably benign	Het
Gm4841	A	T	18: 60,270,948	Y24*	probably null	Het
Gm9825	A	T	6: 7,983,124		noncoding transcript	Het
Greb1	G	A	12: 16,690,894	R1396C	probably benign	Het
Hectd1	C	T	12: 51,753,807	C2076Y	probably damaging	Het
Hnrnpu	A	G	1: 178,325,241		probably benign	Het
Ice2	T	C	9: 69,415,648	I475T	probably benign	Het
Ifit1bl1	T	A	19: 34,594,193	Q288L	probably damaging	Het
Ik	T	C	18: 36,756,818		probably benign	Het
Kidins220	C	T	12: 25,013,446		probably benign	Het
Kmt2c	T	C	5: 25,372,974	D768G	probably benign	Het
Kmt2e	A	G	5: 23,492,364	T87A	probably damaging	Het
Lama5	G	A	2: 180,195,481		probably benign	Het
Lmbr1l	A	G	15: 98,912,476	S85P	probably damaging	Het
Lrig2	A	G	3: 104,467,366		probably benign	Het
Lrig3	A	G	10: 126,010,075	D791G	probably damaging	Het
Lrrc2	G	A	9: 110,980,840	V315M	probably benign	Het
Lrrc4b	A	G	7: 44,462,399	D565G	probably benign	Het
Mpped1	C	T	15: 83,791,990		probably benign	Het
Msrb2	T	A	2: 19,383,303	D87E	probably benign	Het
Muc20	T	C	16: 32,794,141	T289A	possibly damaging	Het
Myo15	C	A	11: 60,478,412	P666Q	possibly damaging	Het
Nfat5	C	T	8: 107,361,789	P579L	probably damaging	Het
Nipbl	A	C	15: 8,319,488	M1920R	probably damaging	Het
Nuak1	T	C	10: 84,374,874		probably null	Het
Nup210l	A	G	3: 90,189,486	E1334G	probably damaging	Het
Olfr12	G	A	1: 92,620,620	G238E	possibly damaging	Het
Olfr1410	A	T	1: 92,608,109	N91Y	possibly damaging	Het
Olfr262	T	A	19: 12,241,455	I69F	probably benign	Het
Olfr675	A	T	7: 105,024,163	N272K	probably benign	Het
Olfr804	T	C	10: 129,705,705	Y276H	probably benign	Het
P4ha3	A	T	7: 100,300,691		probably null	Het
Pbld2	C	T	10: 63,054,371	A186V	probably benign	Het
Pcdh18	A	T	3: 49,755,634	Y411N	probably benign	Het
Pgf	A	G	12: 85,171,767	S70P	probably benign	Het
Phrf1	T	A	7: 141,232,456	D44E	probably benign	Het
Pla2g4a	A	G	1: 149,902,445		probably benign	Het
Plce1	A	G	19: 38,780,790		probably benign	Het
Plxna2	A	G	1: 194,810,970	N1851S	probably benign	Het
Prl7a2	G	A	13: 27,659,271	T183I	probably damaging	Het
Ptger4	A	T	15: 5,235,095	L335H	probably damaging	Het
Ptgr1	A	G	4: 58,984,865		probably benign	Het
Rdh7	A	G	10: 127,884,721	S261P	probably benign	Het
Reg3a	A	G	6: 78,383,286	T150A	probably benign	Het
Rnf111	A	G	9: 70,476,112	S180P	probably benign	Het
Rnf17	A	G	14: 56,522,399	M1554V	probably damaging	Het
Rnf215	T	A	11: 4,135,873	Y117*	probably null	Het
Rogdi	T	C	16: 5,010,505	T165A	probably benign	Het
Scube1	A	G	15: 83,610,204	F844S	probably damaging	Het
Sdr16c6	T	A	4: 4,058,814	E257D	probably benign	Het
Sim1	C	A	10: 50,981,553	C466*	probably null	Het
Spi1	T	A	2: 91,099,522	H46Q	probably damaging	Het
Sumf2	C	A	5: 129,845,068		probably benign	Het
Tbcb	A	G	7: 30,231,612	Y28H	probably benign	Het
Tecta	C	T	9: 42,343,631	C1752Y	probably damaging	Het
Tep1	T	C	14: 50,829,622		probably benign	Het
Tmem245	A	T	4: 56,903,968	W591R	probably damaging	Het
Tnxb	A	G	17: 34,683,574	I1134V	probably benign	Het
Trim13	G	T	14: 61,605,619	A362S	probably benign	Het
Trim47	T	A	11: 116,109,820	D134V	probably damaging	Het
Ttc26	T	A	6: 38,409,476	D377E	possibly damaging	Het
Utrn	C	A	10: 12,436,364	D616Y	probably damaging	Het
Vnn1	G	T	10: 23,899,517	A222S	possibly damaging	Het
Wdr17	A	G	8: 54,690,214	W110R	probably damaging	Het
Wwp1	G	T	4: 19,627,892	Y700*	probably null	Het
Zbtb21	T	C	16: 97,950,585	S661G	probably benign	Het
Zfp955b	A	G	17: 33,302,814	K419R	probably benign	Het

Other mutations in Rpe65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Rpe65	APN	3	159614542	missense	probably damaging	0.99
IGL01446:Rpe65	APN	3	159600405	splice site	probably benign
IGL01815:Rpe65	APN	3	159604530	splice site	probably null
IGL02085:Rpe65	APN	3	159615646	missense	probably benign	0.00
IGL02232:Rpe65	APN	3	159604351	missense	possibly damaging	0.93
IGL02248:Rpe65	APN	3	159624705	missense	probably damaging	1.00
IGL02645:Rpe65	APN	3	159606491	missense	probably damaging	0.99
IGL02711:Rpe65	APN	3	159622877	missense	possibly damaging	0.84
IGL02982:Rpe65	APN	3	159600361	missense	probably damaging	0.99
IGL03280:Rpe65	APN	3	159604341	missense	probably damaging	0.96
IGL03350:Rpe65	APN	3	159614517	missense	possibly damaging	0.75
IGL03356:Rpe65	APN	3	159615577	missense	possibly damaging	0.89
I1329:Rpe65	UTSW	3	159624723	missense	probably benign	0.35
R0571:Rpe65	UTSW	3	159600349	missense	probably damaging	1.00
R0905:Rpe65	UTSW	3	159601583	missense	possibly damaging	0.95
R1024:Rpe65	UTSW	3	159606485	missense	probably benign	0.07
R1597:Rpe65	UTSW	3	159614784	missense	probably damaging	0.97
R1657:Rpe65	UTSW	3	159614448	missense	probably damaging	0.97
R1970:Rpe65	UTSW	3	159615670	missense	probably benign
R2259:Rpe65	UTSW	3	159615571	missense	probably damaging	1.00
R3012:Rpe65	UTSW	3	159604563	missense	possibly damaging	0.61
R3923:Rpe65	UTSW	3	159604400	missense	probably benign	0.16
R3975:Rpe65	UTSW	3	159604585	missense	probably damaging	1.00
R4204:Rpe65	UTSW	3	159604410	missense	probably damaging	0.99
R4825:Rpe65	UTSW	3	159624681	missense	probably benign
R4924:Rpe65	UTSW	3	159622631	missense	probably benign	0.01
R5269:Rpe65	UTSW	3	159604347	missense	probably benign	0.07
R5324:Rpe65	UTSW	3	159604404	missense	possibly damaging	0.94
R5441:Rpe65	UTSW	3	159604401	missense	probably damaging	1.00
R5854:Rpe65	UTSW	3	159615676	missense	probably benign
R5907:Rpe65	UTSW	3	159615682	critical splice donor site	probably null
R6149:Rpe65	UTSW	3	159614143	missense	probably benign
R6660:Rpe65	UTSW	3	159614708	missense	probably damaging	0.98
R6830:Rpe65	UTSW	3	159614168	missense	probably benign	0.06
R7025:Rpe65	UTSW	3	159622685	missense	probably damaging	1.00
R7092:Rpe65	UTSW	3	159615591	missense	probably damaging	1.00
R7203:Rpe65	UTSW	3	159622854	missense	probably damaging	0.99
R7366:Rpe65	UTSW	3	159624729	missense	probably benign	0.13
R7537:Rpe65	UTSW	3	159604609	missense	probably damaging	0.98
R7679:Rpe65	UTSW	3	159604393	missense	probably damaging	1.00
R8044:Rpe65	UTSW	3	159614705	missense	probably benign
R8179:Rpe65	UTSW	3	159624699	missense	probably benign	0.06
R8409:Rpe65	UTSW	3	159614148	missense	probably benign	0.01
R8558:Rpe65	UTSW	3	159614792	missense	probably damaging	1.00
R9042:Rpe65	UTSW	3	159615655	missense	probably damaging	1.00
R9483:Rpe65	UTSW	3	159622681	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCAGAAATTTAGTCACACTGCCCC -3'
(R):5'- AAGAATCTGGCTCTTGCCACATCC -3'

Sequencing Primer
(F):5'- TGCCACAGCCACTCTGC -3'
(R):5'- CATCCAGATTTCTTTAGTTTTGACG -3'

Posted On

2014-05-23