Incidental Mutation 'R1779:Ephb2'
ID197322
Institutional Source Beutler Lab
Gene Symbol Ephb2
Ensembl Gene ENSMUSG00000028664
Gene NameEph receptor B2
SynonymsErk, eteck, Tyro5, Prkm5, Drt, Hek5, Sek3, Qek5, Cek5, Nuk
MMRRC Submission 039810-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.731) question?
Stock #R1779 (G1)
Quality Score208
Status Validated
Chromosome4
Chromosomal Location136647539-136835988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136693825 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 405 (T405A)
Ref Sequence ENSEMBL: ENSMUSP00000101472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059287] [ENSMUST00000105845] [ENSMUST00000105846]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059287
AA Change: T405A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000058135
Gene: ENSMUSG00000028664
AA Change: T405A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 261 304 8.1e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 518 1.23e-10 SMART
Pfam:EphA2_TM 545 619 6e-25 PFAM
TyrKc 622 881 1.34e-138 SMART
SAM 911 978 1.18e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105845
AA Change: T405A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101471
Gene: ENSMUSG00000028664
AA Change: T405A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 259 305 2.2e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 517 1.41e-10 SMART
Pfam:EphA2_TM 543 618 2.1e-30 PFAM
TyrKc 621 880 1.34e-138 SMART
SAM 910 977 1.18e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105846
AA Change: T405A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101472
Gene: ENSMUSG00000028664
AA Change: T405A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 259 305 2.2e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 517 1.41e-10 SMART
Pfam:EphA2_TM 543 619 1e-30 PFAM
TyrKc 622 881 1.34e-138 SMART
SAM 911 978 1.18e-23 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156558
AA Change: T72A
SMART Domains Protein: ENSMUSP00000116350
Gene: ENSMUSG00000028664
AA Change: T72A

DomainStartEndE-ValueType
FN3 1 85 6.48e1 SMART
FN3 104 186 1.23e-10 SMART
Pfam:EphA2_TM 213 276 2.5e-16 PFAM
Meta Mutation Damage Score 0.4015 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: This gene encodes a member of the Eph receptor family of receptor tyrosine kinase transmembrane glycoproteins. These receptors consist of an N-terminal glycosylated ligand-binding domain, a transmembrane region and an intracellular kinase domain. The encoded receptor preferentially binds membrane-bound ephrin-B ligands and is involved in nervous system and vascular development. This gene is used as a marker of intestinal stem cells. Homozygous knockout mice for this gene exhibit impaired axon guidance and vestibular function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal axon guidance, circling, head bobbing, and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T G 3: 124,406,514 L476F probably damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
4930432E11Rik A T 7: 29,579,166 noncoding transcript Het
A930011G23Rik A T 5: 99,223,038 probably benign Het
Abcd3 A G 3: 121,781,963 Y217H probably damaging Het
Abraxas1 A T 5: 100,817,956 probably benign Het
Acsbg1 T C 9: 54,616,062 Y427C probably damaging Het
Adam10 T A 9: 70,776,369 probably benign Het
Adam24 G A 8: 40,680,965 V491I possibly damaging Het
Adamts2 T G 11: 50,756,697 V299G probably damaging Het
Adh7 A G 3: 138,223,991 T143A probably damaging Het
Ahcyl1 A G 3: 107,674,103 S81P probably benign Het
Arhgap20 C A 9: 51,849,915 T986K probably benign Het
Atp13a5 A T 16: 29,314,660 I391N possibly damaging Het
Atp6v0a1 C A 11: 101,026,685 A143E probably benign Het
Calcrl A G 2: 84,351,285 I173T probably damaging Het
Casz1 A G 4: 148,932,937 T228A probably benign Het
Cckar A G 5: 53,699,979 I292T probably damaging Het
Cfhr2 T A 1: 139,858,645 probably null Het
Chkb T C 15: 89,429,057 I109V possibly damaging Het
Clec2i T C 6: 128,888,106 probably null Het
Clec4a4 T A 6: 123,023,975 W216R probably damaging Het
Cntnap1 A C 11: 101,186,511 I1000L probably damaging Het
Cp C A 3: 19,957,385 D34E possibly damaging Het
Cse1l T C 2: 166,940,124 probably null Het
Dennd3 T C 15: 73,522,508 probably null Het
Dnah7a A G 1: 53,577,223 V1193A probably benign Het
Eaf2 A G 16: 36,810,470 probably null Het
Fam117a G A 11: 95,378,953 V348M probably damaging Het
Fh1 T C 1: 175,601,424 *167W probably null Het
Fmo9 T A 1: 166,663,299 I486F probably benign Het
Gabbr1 T A 17: 37,054,879 I150N probably damaging Het
Gfpt1 T C 6: 87,077,197 V478A possibly damaging Het
Gm11639 T A 11: 104,720,939 S536T probably benign Het
Gm2663 A T 6: 40,997,960 V59E probably damaging Het
Gm4868 T A 5: 125,848,112 noncoding transcript Het
Heatr4 T A 12: 83,980,160 T108S probably benign Het
Hells G T 19: 38,946,842 A319S probably benign Het
Helz2 A G 2: 181,234,987 V1238A probably benign Het
Helz2 T A 2: 181,238,459 Q488L possibly damaging Het
Hkdc1 A G 10: 62,391,383 F765S probably damaging Het
Hspg2 T A 4: 137,518,509 W938R probably damaging Het
Itpr2 G A 6: 146,158,901 R2473* probably null Het
Kctd1 C T 18: 15,061,782 V595I probably benign Het
Krt7 A G 15: 101,423,409 Y369C probably damaging Het
Krt72 T C 15: 101,780,929 T323A probably benign Het
Krt76 A G 15: 101,892,687 L58P unknown Het
Liph C A 16: 21,968,050 R272L probably benign Het
Lrrc9 A T 12: 72,455,998 K248* probably null Het
Mei4 T A 9: 81,927,142 S93T probably damaging Het
Mgll T A 6: 88,813,948 Y183* probably null Het
Myo5b A G 18: 74,742,147 M1541V probably benign Het
Napg A G 18: 62,982,691 E66G probably benign Het
Npr3 T C 15: 11,851,486 D406G probably damaging Het
Nr2c2 A G 6: 92,159,243 T355A possibly damaging Het
Olfr1243 A T 2: 89,527,645 I255K probably benign Het
Olfr1461 T C 19: 13,165,040 Y9H probably benign Het
Olfr26 A G 9: 38,855,550 M163V possibly damaging Het
Olfr618 A T 7: 103,597,900 I195F probably damaging Het
Olfr624 A G 7: 103,670,638 I131T probably benign Het
Olfr631 G T 7: 103,929,461 V213L probably benign Het
Olfr71 G A 4: 43,706,041 H176Y probably damaging Het
Orai2 T C 5: 136,150,939 E80G probably damaging Het
Pcdhb14 T A 18: 37,449,482 V547E probably damaging Het
Pcdhb15 T C 18: 37,476,031 I772T possibly damaging Het
Pcnt T C 10: 76,408,796 Q1150R probably damaging Het
Pdcd6 A G 13: 74,305,581 I146T probably damaging Het
Phldb2 T A 16: 45,801,625 D664V probably damaging Het
Pik3ap1 A T 19: 41,332,234 V182E probably damaging Het
Pip4k2a A G 2: 18,847,622 V283A probably benign Het
Pkdrej A G 15: 85,821,171 V188A possibly damaging Het
Pnpla6 T C 8: 3,541,404 W1151R probably damaging Het
Ppp1r14c A G 10: 3,366,890 Y75C probably damaging Het
Prl2b1 C T 13: 27,383,469 D224N probably benign Het
Ptgis A G 2: 167,214,858 S270P probably benign Het
Rgs11 C A 17: 26,210,666 A446D probably damaging Het
Rims2 A G 15: 39,681,702 T1531A probably damaging Het
Sbno1 A T 5: 124,388,517 probably benign Het
Scarb2 C G 5: 92,448,557 M409I probably benign Het
Scube3 C T 17: 28,168,379 probably benign Het
Slc44a4 T C 17: 34,921,925 I180T probably damaging Het
Slc9a2 T C 1: 40,742,643 M344T probably damaging Het
Smc3 A T 19: 53,639,369 T860S probably benign Het
Snrpa A G 7: 27,191,749 I99T probably benign Het
Sorcs1 A G 19: 50,175,043 probably benign Het
Sorl1 C T 9: 41,991,482 probably null Het
Suds3 T C 5: 117,105,244 K143R probably benign Het
Supt20 A T 3: 54,714,743 M424L probably benign Het
Tgtp2 T C 11: 49,058,924 M274V probably benign Het
Tmem158 T A 9: 123,259,909 M213L probably benign Het
Tnks C A 8: 34,857,518 R639L probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt10c A C 16: 56,034,575 N232K possibly damaging Het
Trpm6 C T 19: 18,856,217 R1587W probably damaging Het
Trrap G A 5: 144,828,590 V2539I probably benign Het
Tsg101 A G 7: 46,907,087 S115P probably benign Het
Ttll13 G T 7: 80,260,508 V800L probably benign Het
Vmn1r57 A G 7: 5,220,577 T34A possibly damaging Het
Vmn2r118 T A 17: 55,611,530 T121S probably benign Het
Wdr35 A G 12: 8,985,772 I238M possibly damaging Het
Wisp2 G A 2: 163,828,986 V138M probably damaging Het
Zfp81 T A 17: 33,335,106 T245S probably benign Het
Zfyve26 G T 12: 79,278,463 P824Q probably damaging Het
Other mutations in Ephb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ephb2 APN 4 136657484 missense probably damaging 0.96
IGL00963:Ephb2 APN 4 136658951 missense probably benign 0.04
IGL01111:Ephb2 APN 4 136657410 missense probably benign 0.01
IGL01462:Ephb2 APN 4 136771370 missense possibly damaging 0.61
IGL01863:Ephb2 APN 4 136659777 missense probably benign 0.03
IGL02149:Ephb2 APN 4 136693914 missense probably damaging 1.00
IGL02232:Ephb2 APN 4 136657451 missense probably damaging 0.97
IGL02269:Ephb2 APN 4 136771049 missense possibly damaging 0.66
IGL02828:Ephb2 APN 4 136771150 missense probably benign 0.09
IGL03109:Ephb2 APN 4 136771544 missense probably damaging 1.00
IGL03284:Ephb2 APN 4 136661516 missense probably damaging 0.96
Zimbalist UTSW 4 136659709 missense probably damaging 1.00
BB006:Ephb2 UTSW 4 136660884 missense probably damaging 1.00
BB016:Ephb2 UTSW 4 136660884 missense probably damaging 1.00
PIT4453001:Ephb2 UTSW 4 136660810 missense probably benign 0.00
R0004:Ephb2 UTSW 4 136657524 missense probably damaging 1.00
R0121:Ephb2 UTSW 4 136771057 missense probably damaging 0.99
R0539:Ephb2 UTSW 4 136655976 missense probably damaging 1.00
R0614:Ephb2 UTSW 4 136673365 missense probably benign 0.00
R0988:Ephb2 UTSW 4 136659708 missense possibly damaging 0.59
R1471:Ephb2 UTSW 4 136658951 missense probably benign 0.04
R1473:Ephb2 UTSW 4 136694058 missense possibly damaging 0.83
R1546:Ephb2 UTSW 4 136771009 missense probably damaging 0.99
R1639:Ephb2 UTSW 4 136693905 missense probably benign 0.10
R1725:Ephb2 UTSW 4 136659778 nonsense probably null
R1818:Ephb2 UTSW 4 136655336 missense probably benign 0.02
R2099:Ephb2 UTSW 4 136660755 missense probably damaging 1.00
R2916:Ephb2 UTSW 4 136683945 missense probably damaging 0.99
R3885:Ephb2 UTSW 4 136771034 missense probably damaging 1.00
R4572:Ephb2 UTSW 4 136655940 missense probably damaging 1.00
R4709:Ephb2 UTSW 4 136696052 missense probably damaging 1.00
R4893:Ephb2 UTSW 4 136659753 missense probably damaging 0.99
R4981:Ephb2 UTSW 4 136696010 missense probably benign 0.09
R4992:Ephb2 UTSW 4 136660839 missense probably damaging 1.00
R5004:Ephb2 UTSW 4 136659699 missense possibly damaging 0.77
R5307:Ephb2 UTSW 4 136693787 missense possibly damaging 0.89
R5370:Ephb2 UTSW 4 136771570 missense probably benign 0.00
R5561:Ephb2 UTSW 4 136661406 missense probably damaging 1.00
R5643:Ephb2 UTSW 4 136771612 missense probably damaging 0.99
R5826:Ephb2 UTSW 4 136660737 missense probably damaging 1.00
R5858:Ephb2 UTSW 4 136672445 missense probably benign
R5867:Ephb2 UTSW 4 136675422 missense possibly damaging 0.81
R5990:Ephb2 UTSW 4 136696055 missense probably benign 0.03
R6000:Ephb2 UTSW 4 136684030 missense possibly damaging 0.76
R6156:Ephb2 UTSW 4 136661505 missense probably benign 0.44
R6413:Ephb2 UTSW 4 136771122 missense probably benign 0.08
R6577:Ephb2 UTSW 4 136657550 missense probably damaging 0.99
R6633:Ephb2 UTSW 4 136683996 missense probably benign 0.07
R6720:Ephb2 UTSW 4 136657502 missense probably damaging 0.99
R6795:Ephb2 UTSW 4 136673335 missense possibly damaging 0.88
R7235:Ephb2 UTSW 4 136693828 missense probably damaging 1.00
R7260:Ephb2 UTSW 4 136771574 missense probably damaging 0.96
R7328:Ephb2 UTSW 4 136658934 critical splice donor site probably null
R7404:Ephb2 UTSW 4 136771213 missense probably damaging 1.00
R7466:Ephb2 UTSW 4 136659065 missense probably damaging 1.00
R7524:Ephb2 UTSW 4 136659709 missense probably damaging 1.00
R7605:Ephb2 UTSW 4 136771108 missense probably damaging 1.00
R7611:Ephb2 UTSW 4 136660901 critical splice acceptor site probably null
R7777:Ephb2 UTSW 4 136771636 missense possibly damaging 0.92
R7889:Ephb2 UTSW 4 136771042 missense probably damaging 0.99
R7929:Ephb2 UTSW 4 136660884 missense probably damaging 1.00
R8191:Ephb2 UTSW 4 136658945 missense probably damaging 0.96
R8370:Ephb2 UTSW 4 136655991 missense possibly damaging 0.95
R8444:Ephb2 UTSW 4 136661400 missense probably damaging 1.00
R8724:Ephb2 UTSW 4 136771057 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAATCCAGGTCTTACACATGCGAGG -3'
(R):5'- GCACTGAATGGAGACAGTACCCAC -3'

Sequencing Primer
(F):5'- gcaaatactactactgagcccc -3'
(R):5'- TCCCTCATGCTAGAGTGGAC -3'
Posted On2014-05-23