Mutagenetix > Incidental Mutation

Incidental Mutation 'R1779:Itpr2'

197340

Institutional Source

Beutler Lab

Gene Symbol

Itpr2

Ensembl Gene

ENSMUSG00000030287

Gene Name

inositol 1,4,5-triphosphate receptor 2

Synonyms

Itpr5, Ip3r2

MMRRC Submission

039810-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1779 (G1)

Quality Score

212

Status

Validated

Chromosome

Chromosomal Location

146108299-146502223 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 146158901 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 2473 (R2473*)

Ref Sequence

ENSEMBL: ENSMUSP00000078526 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000053273
AA Change: R2506*

SMART Domains

Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287
AA Change: R2506*

Domain	Start	End	E-Value	Type
low complexity region	68	80	N/A	INTRINSIC
MIR	112	166	1.1e-5	SMART
MIR	173	223	8.9e-6	SMART
MIR	231	287	5.11e-6	SMART
MIR	294	402	3.73e-8	SMART
Pfam:RYDR_ITPR	473	670	1.5e-62	PFAM
low complexity region	882	890	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1346	1.6e-16	PFAM
low complexity region	1773	1785	N/A	INTRINSIC
low complexity region	1897	1908	N/A	INTRINSIC
Pfam:RIH_assoc	1912	2022	4.6e-34	PFAM
low complexity region	2088	2098	N/A	INTRINSIC
transmembrane domain	2228	2250	N/A	INTRINSIC
Pfam:Ion_trans	2260	2552	5.1e-20	PFAM
coiled coil region	2631	2686	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000079573
AA Change: R2473*

SMART Domains

Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287
AA Change: R2473*

Domain	Start	End	E-Value	Type
low complexity region	68	80	N/A	INTRINSIC
MIR	112	166	1.1e-5	SMART
MIR	198	254	5.11e-6	SMART
MIR	261	369	3.73e-8	SMART
Pfam:RYDR_ITPR	438	644	5.4e-75	PFAM
low complexity region	849	857	N/A	INTRINSIC
Pfam:RYDR_ITPR	1148	1322	7.2e-60	PFAM
low complexity region	1740	1752	N/A	INTRINSIC
Pfam:RIH_assoc	1875	1994	5.8e-35	PFAM
low complexity region	2055	2065	N/A	INTRINSIC
transmembrane domain	2195	2217	N/A	INTRINSIC
transmembrane domain	2230	2249	N/A	INTRINSIC
low complexity region	2268	2279	N/A	INTRINSIC
Pfam:Ion_trans	2281	2507	2.4e-12	PFAM
coiled coil region	2598	2653	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.5%
20x: 93.0%

Validation Efficiency

97% (101/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	G	3: 124,406,514	L476F	probably damaging	Het
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
4930432E11Rik	A	T	7: 29,579,166		noncoding transcript	Het
A930011G23Rik	A	T	5: 99,223,038		probably benign	Het
Abcd3	A	G	3: 121,781,963	Y217H	probably damaging	Het
Abraxas1	A	T	5: 100,817,956		probably benign	Het
Acsbg1	T	C	9: 54,616,062	Y427C	probably damaging	Het
Adam10	T	A	9: 70,776,369		probably benign	Het
Adam24	G	A	8: 40,680,965	V491I	possibly damaging	Het
Adamts2	T	G	11: 50,756,697	V299G	probably damaging	Het
Adh7	A	G	3: 138,223,991	T143A	probably damaging	Het
Ahcyl1	A	G	3: 107,674,103	S81P	probably benign	Het
Arhgap20	C	A	9: 51,849,915	T986K	probably benign	Het
Atp13a5	A	T	16: 29,314,660	I391N	possibly damaging	Het
Atp6v0a1	C	A	11: 101,026,685	A143E	probably benign	Het
Calcrl	A	G	2: 84,351,285	I173T	probably damaging	Het
Casz1	A	G	4: 148,932,937	T228A	probably benign	Het
Cckar	A	G	5: 53,699,979	I292T	probably damaging	Het
Cfhr2	T	A	1: 139,858,645		probably null	Het
Chkb	T	C	15: 89,429,057	I109V	possibly damaging	Het
Clec2i	T	C	6: 128,888,106		probably null	Het
Clec4a4	T	A	6: 123,023,975	W216R	probably damaging	Het
Cntnap1	A	C	11: 101,186,511	I1000L	probably damaging	Het
Cp	C	A	3: 19,957,385	D34E	possibly damaging	Het
Cse1l	T	C	2: 166,940,124		probably null	Het
Dennd3	T	C	15: 73,522,508		probably null	Het
Dnah7a	A	G	1: 53,577,223	V1193A	probably benign	Het
Eaf2	A	G	16: 36,810,470		probably null	Het
Ephb2	T	C	4: 136,693,825	T405A	possibly damaging	Het
Fam117a	G	A	11: 95,378,953	V348M	probably damaging	Het
Fh1	T	C	1: 175,601,424	*167W	probably null	Het
Fmo9	T	A	1: 166,663,299	I486F	probably benign	Het
Gabbr1	T	A	17: 37,054,879	I150N	probably damaging	Het
Gfpt1	T	C	6: 87,077,197	V478A	possibly damaging	Het
Gm11639	T	A	11: 104,720,939	S536T	probably benign	Het
Gm2663	A	T	6: 40,997,960	V59E	probably damaging	Het
Gm4868	T	A	5: 125,848,112		noncoding transcript	Het
Heatr4	T	A	12: 83,980,160	T108S	probably benign	Het
Hells	G	T	19: 38,946,842	A319S	probably benign	Het
Helz2	A	G	2: 181,234,987	V1238A	probably benign	Het
Helz2	T	A	2: 181,238,459	Q488L	possibly damaging	Het
Hkdc1	A	G	10: 62,391,383	F765S	probably damaging	Het
Hspg2	T	A	4: 137,518,509	W938R	probably damaging	Het
Kctd1	C	T	18: 15,061,782	V595I	probably benign	Het
Krt7	A	G	15: 101,423,409	Y369C	probably damaging	Het
Krt72	T	C	15: 101,780,929	T323A	probably benign	Het
Krt76	A	G	15: 101,892,687	L58P	unknown	Het
Liph	C	A	16: 21,968,050	R272L	probably benign	Het
Lrrc9	A	T	12: 72,455,998	K248*	probably null	Het
Mei4	T	A	9: 81,927,142	S93T	probably damaging	Het
Mgll	T	A	6: 88,813,948	Y183*	probably null	Het
Myo5b	A	G	18: 74,742,147	M1541V	probably benign	Het
Napg	A	G	18: 62,982,691	E66G	probably benign	Het
Npr3	T	C	15: 11,851,486	D406G	probably damaging	Het
Nr2c2	A	G	6: 92,159,243	T355A	possibly damaging	Het
Olfr1243	A	T	2: 89,527,645	I255K	probably benign	Het
Olfr1461	T	C	19: 13,165,040	Y9H	probably benign	Het
Olfr26	A	G	9: 38,855,550	M163V	possibly damaging	Het
Olfr618	A	T	7: 103,597,900	I195F	probably damaging	Het
Olfr624	A	G	7: 103,670,638	I131T	probably benign	Het
Olfr631	G	T	7: 103,929,461	V213L	probably benign	Het
Olfr71	G	A	4: 43,706,041	H176Y	probably damaging	Het
Orai2	T	C	5: 136,150,939	E80G	probably damaging	Het
Pcdhb14	T	A	18: 37,449,482	V547E	probably damaging	Het
Pcdhb15	T	C	18: 37,476,031	I772T	possibly damaging	Het
Pcnt	T	C	10: 76,408,796	Q1150R	probably damaging	Het
Pdcd6	A	G	13: 74,305,581	I146T	probably damaging	Het
Phldb2	T	A	16: 45,801,625	D664V	probably damaging	Het
Pik3ap1	A	T	19: 41,332,234	V182E	probably damaging	Het
Pip4k2a	A	G	2: 18,847,622	V283A	probably benign	Het
Pkdrej	A	G	15: 85,821,171	V188A	possibly damaging	Het
Pnpla6	T	C	8: 3,541,404	W1151R	probably damaging	Het
Ppp1r14c	A	G	10: 3,366,890	Y75C	probably damaging	Het
Prl2b1	C	T	13: 27,383,469	D224N	probably benign	Het
Ptgis	A	G	2: 167,214,858	S270P	probably benign	Het
Rgs11	C	A	17: 26,210,666	A446D	probably damaging	Het
Rims2	A	G	15: 39,681,702	T1531A	probably damaging	Het
Sbno1	A	T	5: 124,388,517		probably benign	Het
Scarb2	C	G	5: 92,448,557	M409I	probably benign	Het
Scube3	C	T	17: 28,168,379		probably benign	Het
Slc44a4	T	C	17: 34,921,925	I180T	probably damaging	Het
Slc9a2	T	C	1: 40,742,643	M344T	probably damaging	Het
Smc3	A	T	19: 53,639,369	T860S	probably benign	Het
Snrpa	A	G	7: 27,191,749	I99T	probably benign	Het
Sorcs1	A	G	19: 50,175,043		probably benign	Het
Sorl1	C	T	9: 41,991,482		probably null	Het
Suds3	T	C	5: 117,105,244	K143R	probably benign	Het
Supt20	A	T	3: 54,714,743	M424L	probably benign	Het
Tgtp2	T	C	11: 49,058,924	M274V	probably benign	Het
Tmem158	T	A	9: 123,259,909	M213L	probably benign	Het
Tnks	C	A	8: 34,857,518	R639L	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trmt10c	A	C	16: 56,034,575	N232K	possibly damaging	Het
Trpm6	C	T	19: 18,856,217	R1587W	probably damaging	Het
Trrap	G	A	5: 144,828,590	V2539I	probably benign	Het
Tsg101	A	G	7: 46,907,087	S115P	probably benign	Het
Ttll13	G	T	7: 80,260,508	V800L	probably benign	Het
Vmn1r57	A	G	7: 5,220,577	T34A	possibly damaging	Het
Vmn2r118	T	A	17: 55,611,530	T121S	probably benign	Het
Wdr35	A	G	12: 8,985,772	I238M	possibly damaging	Het
Wisp2	G	A	2: 163,828,986	V138M	probably damaging	Het
Zfp81	T	A	17: 33,335,106	T245S	probably benign	Het
Zfyve26	G	T	12: 79,278,463	P824Q	probably damaging	Het

Other mutations in Itpr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Itpr2	APN	6	146397012	missense	probably damaging	0.99
IGL00163:Itpr2	APN	6	146390836	missense	possibly damaging	0.88
IGL00229:Itpr2	APN	6	146144185	missense	probably damaging	1.00
IGL00712:Itpr2	APN	6	146232436	missense	possibly damaging	0.63
IGL00952:Itpr2	APN	6	146158961	missense	probably damaging	1.00
IGL00983:Itpr2	APN	6	146310981	splice site	probably benign
IGL01012:Itpr2	APN	6	146345161	missense	probably damaging	1.00
IGL01289:Itpr2	APN	6	146112535	nonsense	probably null
IGL01411:Itpr2	APN	6	146376062	critical splice donor site	probably null
IGL01557:Itpr2	APN	6	146158976	missense	probably damaging	0.99
IGL01669:Itpr2	APN	6	146180229	missense	probably damaging	1.00
IGL01809:Itpr2	APN	6	146227581	missense	probably damaging	1.00
IGL01814:Itpr2	APN	6	146232546	missense	probably benign	0.02
IGL02198:Itpr2	APN	6	146323227	missense	probably damaging	1.00
IGL02218:Itpr2	APN	6	146240262	splice site	probably benign
IGL02332:Itpr2	APN	6	146426542	missense	probably damaging	1.00
IGL02425:Itpr2	APN	6	146391321	missense	probably damaging	0.99
IGL02432:Itpr2	APN	6	146325173	missense	probably benign	0.05
IGL02726:Itpr2	APN	6	146375921	missense	probably benign	0.18
IGL02851:Itpr2	APN	6	146385979	missense	probably damaging	0.99
IGL02933:Itpr2	APN	6	146312904	missense	probably benign
IGL03015:Itpr2	APN	6	146375937	missense	probably benign
IGL03067:Itpr2	APN	6	146325182	missense	probably damaging	1.00
IGL03093:Itpr2	APN	6	146379510	missense	probably damaging	1.00
IGL03214:Itpr2	APN	6	146180244	missense	probably benign	0.02
IGL03275:Itpr2	APN	6	146158877	splice site	probably benign
IGL03332:Itpr2	APN	6	146144149	missense	probably damaging	0.98
IGL03352:Itpr2	APN	6	146157104	missense	probably damaging	1.00
IGL03377:Itpr2	APN	6	146329715	missense	probably damaging	0.96
IGL03377:Itpr2	APN	6	146329758	missense	probably benign
dollar_short	UTSW	6	146397019	nonsense	probably null
enfermos	UTSW	6	146234006	missense	probably damaging	0.98
Hopla	UTSW	6	146194598	missense	probably damaging	0.98
P0029:Itpr2	UTSW	6	146379489	missense	probably damaging	1.00
PIT4431001:Itpr2	UTSW	6	146354720	missense	probably benign
PIT4453001:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
PIT4504001:Itpr2	UTSW	6	146229871	missense	probably damaging	0.99
R0040:Itpr2	UTSW	6	146345140	missense	probably damaging	1.00
R0040:Itpr2	UTSW	6	146345140	missense	probably damaging	1.00
R0048:Itpr2	UTSW	6	146232291	splice site	probably null
R0048:Itpr2	UTSW	6	146232291	splice site	probably null
R0055:Itpr2	UTSW	6	146323133	missense	probably benign	0.42
R0055:Itpr2	UTSW	6	146323133	missense	probably benign	0.42
R0088:Itpr2	UTSW	6	146241185	missense	probably benign
R0089:Itpr2	UTSW	6	146350022	critical splice donor site	probably null
R0114:Itpr2	UTSW	6	146312879	missense	probably damaging	1.00
R0125:Itpr2	UTSW	6	146240453	missense	probably benign	0.00
R0144:Itpr2	UTSW	6	146327155	missense	probably damaging	0.98
R0180:Itpr2	UTSW	6	146501909	start gained	probably benign
R0211:Itpr2	UTSW	6	146194613	missense	probably benign	0.17
R0305:Itpr2	UTSW	6	146311103	missense	possibly damaging	0.63
R0367:Itpr2	UTSW	6	146234008	missense	probably damaging	1.00
R0374:Itpr2	UTSW	6	146359392	missense	probably benign	0.00
R0391:Itpr2	UTSW	6	146229773	missense	probably damaging	1.00
R0450:Itpr2	UTSW	6	146417979	missense	possibly damaging	0.66
R0464:Itpr2	UTSW	6	146375889	missense	probably damaging	1.00
R0510:Itpr2	UTSW	6	146417979	missense	possibly damaging	0.66
R0532:Itpr2	UTSW	6	146112400	missense	probably damaging	1.00
R0625:Itpr2	UTSW	6	146166651	missense	probably benign
R0633:Itpr2	UTSW	6	146374456	missense	probably damaging	1.00
R0636:Itpr2	UTSW	6	146171412	missense	probably damaging	1.00
R1086:Itpr2	UTSW	6	146350045	missense	probably damaging	1.00
R1352:Itpr2	UTSW	6	146111742	missense	probably damaging	1.00
R1631:Itpr2	UTSW	6	146180290	missense	probably damaging	1.00
R1655:Itpr2	UTSW	6	146376148	missense	probably damaging	1.00
R1767:Itpr2	UTSW	6	146350068	missense	possibly damaging	0.91
R1796:Itpr2	UTSW	6	146296673	missense	probably benign
R1815:Itpr2	UTSW	6	146359416	missense	probably benign	0.08
R1827:Itpr2	UTSW	6	146328332	missense	probably damaging	1.00
R1828:Itpr2	UTSW	6	146328332	missense	probably damaging	1.00
R1884:Itpr2	UTSW	6	146385971	missense	probably benign	0.16
R1902:Itpr2	UTSW	6	146229703	missense	probably damaging	1.00
R1931:Itpr2	UTSW	6	146240354	missense	probably benign	0.41
R1964:Itpr2	UTSW	6	146111693	missense	probably damaging	1.00
R2010:Itpr2	UTSW	6	146227524	splice site	probably null
R2168:Itpr2	UTSW	6	146111678	missense	probably benign	0.05
R2179:Itpr2	UTSW	6	146375966	missense	probably benign
R2290:Itpr2	UTSW	6	146422828	missense	probably damaging	1.00
R2874:Itpr2	UTSW	6	146426498	missense	possibly damaging	0.73
R2888:Itpr2	UTSW	6	146171293	missense	probably damaging	1.00
R2897:Itpr2	UTSW	6	146173341	missense	probably benign	0.03
R2897:Itpr2	UTSW	6	146323169	missense	probably damaging	1.00
R2898:Itpr2	UTSW	6	146173341	missense	probably benign	0.03
R2898:Itpr2	UTSW	6	146323169	missense	probably damaging	1.00
R3024:Itpr2	UTSW	6	146180310	missense	probably benign	0.35
R3104:Itpr2	UTSW	6	146312837	critical splice donor site	probably null
R3607:Itpr2	UTSW	6	146227601	missense	probably damaging	0.98
R3732:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3732:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3733:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3792:Itpr2	UTSW	6	146415354	missense	probably damaging	1.00
R3806:Itpr2	UTSW	6	146232291	splice site	probably null
R3821:Itpr2	UTSW	6	146417726	missense	probably damaging	1.00
R3929:Itpr2	UTSW	6	146374359	splice site	probably null
R3958:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R3959:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R3960:Itpr2	UTSW	6	146229764	missense	probably damaging	1.00
R3960:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4074:Itpr2	UTSW	6	146373244	splice site	probably null
R4085:Itpr2	UTSW	6	146144248	missense	probably damaging	1.00
R4114:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4115:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4588:Itpr2	UTSW	6	146241196	missense	probably benign	0.33
R4663:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4673:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4684:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4686:Itpr2	UTSW	6	146229775	missense	probably damaging	1.00
R4713:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4713:Itpr2	UTSW	6	146396958	missense	probably damaging	1.00
R4729:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4732:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4733:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4801:Itpr2	UTSW	6	146371331	missense	probably damaging	1.00
R4802:Itpr2	UTSW	6	146371331	missense	probably damaging	1.00
R4877:Itpr2	UTSW	6	146325205	missense	probably damaging	1.00
R4970:Itpr2	UTSW	6	146233991	missense	possibly damaging	0.95
R4986:Itpr2	UTSW	6	146240342	missense	probably damaging	0.96
R5112:Itpr2	UTSW	6	146233991	missense	possibly damaging	0.95
R5200:Itpr2	UTSW	6	146144107	critical splice donor site	probably null
R5224:Itpr2	UTSW	6	146166651	missense	probably benign
R5243:Itpr2	UTSW	6	146187546	missense	probably damaging	1.00
R5348:Itpr2	UTSW	6	146476693	missense	possibly damaging	0.78
R5393:Itpr2	UTSW	6	146376155	nonsense	probably null
R5552:Itpr2	UTSW	6	146294080	missense	probably benign
R5579:Itpr2	UTSW	6	146173366	nonsense	probably null
R5744:Itpr2	UTSW	6	146376151	missense	probably damaging	1.00
R5825:Itpr2	UTSW	6	146144149	missense	probably damaging	0.98
R5910:Itpr2	UTSW	6	146329571	missense	probably benign	0.10
R5911:Itpr2	UTSW	6	146312943	missense	probably benign	0.42
R6044:Itpr2	UTSW	6	146396951	missense	probably null	0.98
R6072:Itpr2	UTSW	6	146347111	missense	probably damaging	0.98
R6191:Itpr2	UTSW	6	146328335	missense	probably benign	0.01
R6483:Itpr2	UTSW	6	146112477	missense	possibly damaging	0.52
R6511:Itpr2	UTSW	6	146329727	missense	probably damaging	1.00
R6524:Itpr2	UTSW	6	146345211	missense	probably benign	0.01
R6561:Itpr2	UTSW	6	146234006	missense	probably damaging	0.98
R6594:Itpr2	UTSW	6	146190480	missense	possibly damaging	0.71
R6603:Itpr2	UTSW	6	146347171	missense	probably damaging	0.98
R6736:Itpr2	UTSW	6	146325170	missense	probably damaging	1.00
R6783:Itpr2	UTSW	6	146385873	critical splice donor site	probably null
R6831:Itpr2	UTSW	6	146112429	missense	probably damaging	1.00
R6857:Itpr2	UTSW	6	146397019	nonsense	probably null
R7103:Itpr2	UTSW	6	146325074	missense	probably damaging	1.00
R7111:Itpr2	UTSW	6	146325056	missense	probably damaging	1.00
R7126:Itpr2	UTSW	6	146357796	nonsense	probably null
R7165:Itpr2	UTSW	6	146294091	missense	probably damaging	1.00
R7184:Itpr2	UTSW	6	146311087	missense	possibly damaging	0.79
R7249:Itpr2	UTSW	6	146311052	missense	probably damaging	1.00
R7292:Itpr2	UTSW	6	146158949	missense	possibly damaging	0.95
R7342:Itpr2	UTSW	6	146327187	missense	probably damaging	0.98
R7392:Itpr2	UTSW	6	146359340	missense	possibly damaging	0.95
R7414:Itpr2	UTSW	6	146373208	missense	probably benign	0.06
R7448:Itpr2	UTSW	6	146329508	missense	probably damaging	1.00
R7492:Itpr2	UTSW	6	146390938	missense	probably damaging	1.00
R7515:Itpr2	UTSW	6	146327110	missense	probably damaging	1.00
R7529:Itpr2	UTSW	6	146194598	missense	probably damaging	0.98
R7558:Itpr2	UTSW	6	146390865	missense	probably damaging	1.00
R7650:Itpr2	UTSW	6	146233994	missense	probably benign	0.36
R7678:Itpr2	UTSW	6	146187550	missense	probably benign	0.00
R7790:Itpr2	UTSW	6	146224776	missense	probably damaging	1.00
R7798:Itpr2	UTSW	6	146386015	missense	probably benign	0.06
R7831:Itpr2	UTSW	6	146291584	missense	probably benign	0.04
R8023:Itpr2	UTSW	6	146187490	missense	probably damaging	0.97
R8046:Itpr2	UTSW	6	146426459	missense	probably damaging	0.96
R8236:Itpr2	UTSW	6	146390783	critical splice donor site	probably null
R8241:Itpr2	UTSW	6	146418515	missense	possibly damaging	0.90
R8245:Itpr2	UTSW	6	146373106	missense	probably damaging	0.98
R8324:Itpr2	UTSW	6	146328398	missense	probably damaging	0.97
R8339:Itpr2	UTSW	6	146312898	missense	probably benign	0.19
R8458:Itpr2	UTSW	6	146233966	missense	possibly damaging	0.62
R8506:Itpr2	UTSW	6	146418416	critical splice donor site	probably null
R8529:Itpr2	UTSW	6	146329553	missense	probably damaging	1.00
R8672:Itpr2	UTSW	6	146374518	missense	probably damaging	1.00
R8755:Itpr2	UTSW	6	146232428	missense	probably benign
R8816:Itpr2	UTSW	6	146241212	missense	probably damaging	0.98
R9160:Itpr2	UTSW	6	146374601	missense	probably damaging	1.00
R9273:Itpr2	UTSW	6	146325031	missense	probably damaging	1.00
R9284:Itpr2	UTSW	6	146354676	missense	probably benign	0.01
R9322:Itpr2	UTSW	6	146325089	missense	probably benign	0.19
R9357:Itpr2	UTSW	6	146359316	missense	probably damaging	1.00
R9424:Itpr2	UTSW	6	146311007	missense	probably damaging	0.98
R9438:Itpr2	UTSW	6	146166668	missense	probably benign
R9576:Itpr2	UTSW	6	146311007	missense	probably damaging	0.98
V8831:Itpr2	UTSW	6	146385882	missense	probably damaging	1.00
X0054:Itpr2	UTSW	6	146323236	missense	probably damaging	1.00
X0063:Itpr2	UTSW	6	146180353	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACGGCTACACTTTTAAGGCAAATG -3'
(R):5'- TCAGAAGCAGATTCTCCGATGTTCAC -3'

Sequencing Primer
(F):5'- ggcaggaggacagcaac -3'
(R):5'- CCGATGTTCACAATGGTGC -3'

Posted On

2014-05-23