Mutagenetix > Incidental Mutation

Incidental Mutation 'R1779:Sorl1'

197356

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

2900010L19Rik, mSorLA, Sorla, LR11

MMRRC Submission

039810-MU

Accession Numbers

Genbank: NM_011436; MGI: 1202296

Essential gene?

Possibly non essential (E-score: 0.338) question?

Stock #

R1779 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41964720-42124297 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

C to T at 41991482 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989] [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

probably null
Transcript: ENSMUST00000060989

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000060989

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Meta Mutation Damage Score

0.9593

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.5%
20x: 93.0%

Validation Efficiency

97% (101/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	G	3: 124,406,514	L476F	probably damaging	Het
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
4930432E11Rik	A	T	7: 29,579,166		noncoding transcript	Het
A930011G23Rik	A	T	5: 99,223,038		probably benign	Het
Abcd3	A	G	3: 121,781,963	Y217H	probably damaging	Het
Abraxas1	A	T	5: 100,817,956		probably benign	Het
Acsbg1	T	C	9: 54,616,062	Y427C	probably damaging	Het
Adam10	T	A	9: 70,776,369		probably benign	Het
Adam24	G	A	8: 40,680,965	V491I	possibly damaging	Het
Adamts2	T	G	11: 50,756,697	V299G	probably damaging	Het
Adh7	A	G	3: 138,223,991	T143A	probably damaging	Het
Ahcyl1	A	G	3: 107,674,103	S81P	probably benign	Het
Arhgap20	C	A	9: 51,849,915	T986K	probably benign	Het
Atp13a5	A	T	16: 29,314,660	I391N	possibly damaging	Het
Atp6v0a1	C	A	11: 101,026,685	A143E	probably benign	Het
Calcrl	A	G	2: 84,351,285	I173T	probably damaging	Het
Casz1	A	G	4: 148,932,937	T228A	probably benign	Het
Cckar	A	G	5: 53,699,979	I292T	probably damaging	Het
Cfhr2	T	A	1: 139,858,645		probably null	Het
Chkb	T	C	15: 89,429,057	I109V	possibly damaging	Het
Clec2i	T	C	6: 128,888,106		probably null	Het
Clec4a4	T	A	6: 123,023,975	W216R	probably damaging	Het
Cntnap1	A	C	11: 101,186,511	I1000L	probably damaging	Het
Cp	C	A	3: 19,957,385	D34E	possibly damaging	Het
Cse1l	T	C	2: 166,940,124		probably null	Het
Dennd3	T	C	15: 73,522,508		probably null	Het
Dnah7a	A	G	1: 53,577,223	V1193A	probably benign	Het
Eaf2	A	G	16: 36,810,470		probably null	Het
Ephb2	T	C	4: 136,693,825	T405A	possibly damaging	Het
Fam117a	G	A	11: 95,378,953	V348M	probably damaging	Het
Fh1	T	C	1: 175,601,424	*167W	probably null	Het
Fmo9	T	A	1: 166,663,299	I486F	probably benign	Het
Gabbr1	T	A	17: 37,054,879	I150N	probably damaging	Het
Gfpt1	T	C	6: 87,077,197	V478A	possibly damaging	Het
Gm11639	T	A	11: 104,720,939	S536T	probably benign	Het
Gm2663	A	T	6: 40,997,960	V59E	probably damaging	Het
Gm4868	T	A	5: 125,848,112		noncoding transcript	Het
Heatr4	T	A	12: 83,980,160	T108S	probably benign	Het
Hells	G	T	19: 38,946,842	A319S	probably benign	Het
Helz2	A	G	2: 181,234,987	V1238A	probably benign	Het
Helz2	T	A	2: 181,238,459	Q488L	possibly damaging	Het
Hkdc1	A	G	10: 62,391,383	F765S	probably damaging	Het
Hspg2	T	A	4: 137,518,509	W938R	probably damaging	Het
Itpr2	G	A	6: 146,158,901	R2473*	probably null	Het
Kctd1	C	T	18: 15,061,782	V595I	probably benign	Het
Krt7	A	G	15: 101,423,409	Y369C	probably damaging	Het
Krt72	T	C	15: 101,780,929	T323A	probably benign	Het
Krt76	A	G	15: 101,892,687	L58P	unknown	Het
Liph	C	A	16: 21,968,050	R272L	probably benign	Het
Lrrc9	A	T	12: 72,455,998	K248*	probably null	Het
Mei4	T	A	9: 81,927,142	S93T	probably damaging	Het
Mgll	T	A	6: 88,813,948	Y183*	probably null	Het
Myo5b	A	G	18: 74,742,147	M1541V	probably benign	Het
Napg	A	G	18: 62,982,691	E66G	probably benign	Het
Npr3	T	C	15: 11,851,486	D406G	probably damaging	Het
Nr2c2	A	G	6: 92,159,243	T355A	possibly damaging	Het
Olfr1243	A	T	2: 89,527,645	I255K	probably benign	Het
Olfr1461	T	C	19: 13,165,040	Y9H	probably benign	Het
Olfr26	A	G	9: 38,855,550	M163V	possibly damaging	Het
Olfr618	A	T	7: 103,597,900	I195F	probably damaging	Het
Olfr624	A	G	7: 103,670,638	I131T	probably benign	Het
Olfr631	G	T	7: 103,929,461	V213L	probably benign	Het
Olfr71	G	A	4: 43,706,041	H176Y	probably damaging	Het
Orai2	T	C	5: 136,150,939	E80G	probably damaging	Het
Pcdhb14	T	A	18: 37,449,482	V547E	probably damaging	Het
Pcdhb15	T	C	18: 37,476,031	I772T	possibly damaging	Het
Pcnt	T	C	10: 76,408,796	Q1150R	probably damaging	Het
Pdcd6	A	G	13: 74,305,581	I146T	probably damaging	Het
Phldb2	T	A	16: 45,801,625	D664V	probably damaging	Het
Pik3ap1	A	T	19: 41,332,234	V182E	probably damaging	Het
Pip4k2a	A	G	2: 18,847,622	V283A	probably benign	Het
Pkdrej	A	G	15: 85,821,171	V188A	possibly damaging	Het
Pnpla6	T	C	8: 3,541,404	W1151R	probably damaging	Het
Ppp1r14c	A	G	10: 3,366,890	Y75C	probably damaging	Het
Prl2b1	C	T	13: 27,383,469	D224N	probably benign	Het
Ptgis	A	G	2: 167,214,858	S270P	probably benign	Het
Rgs11	C	A	17: 26,210,666	A446D	probably damaging	Het
Rims2	A	G	15: 39,681,702	T1531A	probably damaging	Het
Sbno1	A	T	5: 124,388,517		probably benign	Het
Scarb2	C	G	5: 92,448,557	M409I	probably benign	Het
Scube3	C	T	17: 28,168,379		probably benign	Het
Slc44a4	T	C	17: 34,921,925	I180T	probably damaging	Het
Slc9a2	T	C	1: 40,742,643	M344T	probably damaging	Het
Smc3	A	T	19: 53,639,369	T860S	probably benign	Het
Snrpa	A	G	7: 27,191,749	I99T	probably benign	Het
Sorcs1	A	G	19: 50,175,043		probably benign	Het
Suds3	T	C	5: 117,105,244	K143R	probably benign	Het
Supt20	A	T	3: 54,714,743	M424L	probably benign	Het
Tgtp2	T	C	11: 49,058,924	M274V	probably benign	Het
Tmem158	T	A	9: 123,259,909	M213L	probably benign	Het
Tnks	C	A	8: 34,857,518	R639L	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trmt10c	A	C	16: 56,034,575	N232K	possibly damaging	Het
Trpm6	C	T	19: 18,856,217	R1587W	probably damaging	Het
Trrap	G	A	5: 144,828,590	V2539I	probably benign	Het
Tsg101	A	G	7: 46,907,087	S115P	probably benign	Het
Ttll13	G	T	7: 80,260,508	V800L	probably benign	Het
Vmn1r57	A	G	7: 5,220,577	T34A	possibly damaging	Het
Vmn2r118	T	A	17: 55,611,530	T121S	probably benign	Het
Wdr35	A	G	12: 8,985,772	I238M	possibly damaging	Het
Wisp2	G	A	2: 163,828,986	V138M	probably damaging	Het
Zfp81	T	A	17: 33,335,106	T245S	probably benign	Het
Zfyve26	G	T	12: 79,278,463	P824Q	probably damaging	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41974094	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	42024478	splice site	probably benign
IGL01545:Sorl1	APN	9	42043956	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	42057269	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	42001492	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41980711	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	42004034	missense	probably benign
IGL02215:Sorl1	APN	9	42018182	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	42041690	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	42046561	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	42063774	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	42037059	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	42041053	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	42057325	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41991426	missense	probably benign
IGL03288:Sorl1	APN	9	42033562	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	42041596	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41968622	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	42033577	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	42081954	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	42031909	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	42004088	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41991371	missense	probably null	0.00
R0512:Sorl1	UTSW	9	42067832	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41984506	missense	probably damaging	1.00
R0600:Sorl1	UTSW	9	42043900	splice site	probably benign
R0831:Sorl1	UTSW	9	42071069	splice site	probably benign
R0924:Sorl1	UTSW	9	42008174	splice site	probably benign
R1013:Sorl1	UTSW	9	42002559	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41991456	missense	probably benign
R1077:Sorl1	UTSW	9	42014490	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	42031796	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	42000412	splice site	probably null
R1498:Sorl1	UTSW	9	42041073	missense	probably damaging	1.00
R1671:Sorl1	UTSW	9	41974000	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41996242	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42089965	missense	probably benign	0.33
R1871:Sorl1	UTSW	9	41969725	nonsense	probably null
R1912:Sorl1	UTSW	9	42081950	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	42046624	missense	probably benign
R2071:Sorl1	UTSW	9	41979457	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41984492	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41980711	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	42037070	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41969781	missense	probably benign
R3815:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	42004105	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41989468	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	42035448	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	42003992	nonsense	probably null
R4610:Sorl1	UTSW	9	42031914	missense	possibly damaging	0.65
R4664:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4666:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41984508	missense	probably damaging	1.00
R4823:Sorl1	UTSW	9	41992321	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	42063752	missense	probably damaging	0.99
R4898:Sorl1	UTSW	9	42041639	missense	probably damaging	1.00
R4922:Sorl1	UTSW	9	42014450	splice site	probably null
R4976:Sorl1	UTSW	9	41983003	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41991342	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41996294	missense	probably benign
R5070:Sorl1	UTSW	9	42031818	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41976377	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	42033583	missense	probably benign	0.00
R5265:Sorl1	UTSW	9	42106516	missense	possibly damaging	0.80
R5275:Sorl1	UTSW	9	42030902	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41979390	missense	probably benign	0.00
R5385:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5386:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	42002636	nonsense	probably null
R5518:Sorl1	UTSW	9	42037212	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41991625	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42092373	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41983034	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41969742	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41976407	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	42071234	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	42001603	missense	possibly damaging	0.81
R6654:Sorl1	UTSW	9	41980645	missense	possibly damaging	0.47
R6691:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6703:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42092452	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42099263	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	42024398	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	42022392	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	42033626	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41969751	missense	probably benign	0.11
R7033:Sorl1	UTSW	9	42030983	missense	possibly damaging	0.93
R7091:Sorl1	UTSW	9	42002634	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42124079	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	42037203	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	42063710	splice site	probably null
R7537:Sorl1	UTSW	9	41980688	missense	probably benign	0.01
R7615:Sorl1	UTSW	9	41977582	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42092334	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41984526	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	42043909	missense	probably damaging	1.00
R7831:Sorl1	UTSW	9	42089961	missense	probably benign	0.17
R7956:Sorl1	UTSW	9	41989359	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41991401	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	42041561	splice site	probably null
R8261:Sorl1	UTSW	9	42014481	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	42030998	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	42018160	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41974074	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	42022426	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	42000271	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	42046552	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	42071195	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	42063754	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41974124	nonsense	probably null
R9278:Sorl1	UTSW	9	42046561	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	42041631	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41989443	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	42067933	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	42001518	missense	probably damaging	1.00
R9468:Sorl1	UTSW	9	42124088	missense	probably benign	0.20
R9528:Sorl1	UTSW	9	42022335	critical splice donor site	probably null
R9544:Sorl1	UTSW	9	42081809	nonsense	probably null
R9563:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9564:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9588:Sorl1	UTSW	9	42081809	nonsense	probably null
R9634:Sorl1	UTSW	9	41996294	missense	probably benign
R9671:Sorl1	UTSW	9	42031781	missense	possibly damaging	0.85
R9701:Sorl1	UTSW	9	42092470	missense	probably damaging	1.00
Z1176:Sorl1	UTSW	9	42099203	missense	possibly damaging	0.64
Z1176:Sorl1	UTSW	9	42123948	missense	probably benign	0.03
Z1177:Sorl1	UTSW	9	41991638	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42106541	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	42123912	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	42041596	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGAGTCCTGAGGGTCACAAAGTC -3'
(R):5'- AGTGCAGAATCTCCAGTGGACAGC -3'

Sequencing Primer
(F):5'- CTGAGGGTCACAAAGTCATTGG -3'
(R):5'- CCGGAGATGTGACTTTGACC -3'

Posted On

2014-05-23