Incidental Mutation 'R1779:Pkdrej'
ID197380
Institutional Source Beutler Lab
Gene Symbol Pkdrej
Ensembl Gene ENSMUSG00000052496
Gene Namepolycystin (PKD) family receptor for egg jelly
Synonyms
MMRRC Submission 039810-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1779 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location85814670-85821734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85821171 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 188 (V188A)
Ref Sequence ENSEMBL: ENSMUSP00000086352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064370]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064370
AA Change: V188A

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000086352
Gene: ENSMUSG00000052496
AA Change: V188A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:REJ 130 598 6.2e-116 PFAM
coiled coil region 657 687 N/A INTRINSIC
low complexity region 942 947 N/A INTRINSIC
GPS 984 1050 1.37e-2 SMART
transmembrane domain 1067 1089 N/A INTRINSIC
LH2 1114 1230 3.35e-6 SMART
transmembrane domain 1274 1292 N/A INTRINSIC
transmembrane domain 1312 1334 N/A INTRINSIC
low complexity region 1407 1415 N/A INTRINSIC
transmembrane domain 1451 1473 N/A INTRINSIC
transmembrane domain 1483 1505 N/A INTRINSIC
low complexity region 1571 1579 N/A INTRINSIC
transmembrane domain 1581 1603 N/A INTRINSIC
Pfam:PKD_channel 1621 2051 5.2e-154 PFAM
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a receptor for egg jelly (REJ) domain, a G-protein-coupled receptor proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may play a role in human reproduction. Alternative splice variants have been described but their biological natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are fertile in unrestricted mating trials but show lower reproductive success in sequential mating and artificial insemination trials. Although mutant sperm are able to capacitate in vitro, they acquire exocytotic competence at a slower rate than wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T G 3: 124,406,514 L476F probably damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
4930432E11Rik A T 7: 29,579,166 noncoding transcript Het
A930011G23Rik A T 5: 99,223,038 probably benign Het
Abcd3 A G 3: 121,781,963 Y217H probably damaging Het
Abraxas1 A T 5: 100,817,956 probably benign Het
Acsbg1 T C 9: 54,616,062 Y427C probably damaging Het
Adam10 T A 9: 70,776,369 probably benign Het
Adam24 G A 8: 40,680,965 V491I possibly damaging Het
Adamts2 T G 11: 50,756,697 V299G probably damaging Het
Adh7 A G 3: 138,223,991 T143A probably damaging Het
Ahcyl1 A G 3: 107,674,103 S81P probably benign Het
Arhgap20 C A 9: 51,849,915 T986K probably benign Het
Atp13a5 A T 16: 29,314,660 I391N possibly damaging Het
Atp6v0a1 C A 11: 101,026,685 A143E probably benign Het
Calcrl A G 2: 84,351,285 I173T probably damaging Het
Casz1 A G 4: 148,932,937 T228A probably benign Het
Cckar A G 5: 53,699,979 I292T probably damaging Het
Cfhr2 T A 1: 139,858,645 probably null Het
Chkb T C 15: 89,429,057 I109V possibly damaging Het
Clec2i T C 6: 128,888,106 probably null Het
Clec4a4 T A 6: 123,023,975 W216R probably damaging Het
Cntnap1 A C 11: 101,186,511 I1000L probably damaging Het
Cp C A 3: 19,957,385 D34E possibly damaging Het
Cse1l T C 2: 166,940,124 probably null Het
Dennd3 T C 15: 73,522,508 probably null Het
Dnah7a A G 1: 53,577,223 V1193A probably benign Het
Eaf2 A G 16: 36,810,470 probably null Het
Ephb2 T C 4: 136,693,825 T405A possibly damaging Het
Fam117a G A 11: 95,378,953 V348M probably damaging Het
Fh1 T C 1: 175,601,424 *167W probably null Het
Fmo9 T A 1: 166,663,299 I486F probably benign Het
Gabbr1 T A 17: 37,054,879 I150N probably damaging Het
Gfpt1 T C 6: 87,077,197 V478A possibly damaging Het
Gm11639 T A 11: 104,720,939 S536T probably benign Het
Gm2663 A T 6: 40,997,960 V59E probably damaging Het
Gm4868 T A 5: 125,848,112 noncoding transcript Het
Heatr4 T A 12: 83,980,160 T108S probably benign Het
Hells G T 19: 38,946,842 A319S probably benign Het
Helz2 A G 2: 181,234,987 V1238A probably benign Het
Helz2 T A 2: 181,238,459 Q488L possibly damaging Het
Hkdc1 A G 10: 62,391,383 F765S probably damaging Het
Hspg2 T A 4: 137,518,509 W938R probably damaging Het
Itpr2 G A 6: 146,158,901 R2473* probably null Het
Kctd1 C T 18: 15,061,782 V595I probably benign Het
Krt7 A G 15: 101,423,409 Y369C probably damaging Het
Krt72 T C 15: 101,780,929 T323A probably benign Het
Krt76 A G 15: 101,892,687 L58P unknown Het
Liph C A 16: 21,968,050 R272L probably benign Het
Lrrc9 A T 12: 72,455,998 K248* probably null Het
Mei4 T A 9: 81,927,142 S93T probably damaging Het
Mgll T A 6: 88,813,948 Y183* probably null Het
Myo5b A G 18: 74,742,147 M1541V probably benign Het
Napg A G 18: 62,982,691 E66G probably benign Het
Npr3 T C 15: 11,851,486 D406G probably damaging Het
Nr2c2 A G 6: 92,159,243 T355A possibly damaging Het
Olfr1243 A T 2: 89,527,645 I255K probably benign Het
Olfr1461 T C 19: 13,165,040 Y9H probably benign Het
Olfr26 A G 9: 38,855,550 M163V possibly damaging Het
Olfr618 A T 7: 103,597,900 I195F probably damaging Het
Olfr624 A G 7: 103,670,638 I131T probably benign Het
Olfr631 G T 7: 103,929,461 V213L probably benign Het
Olfr71 G A 4: 43,706,041 H176Y probably damaging Het
Orai2 T C 5: 136,150,939 E80G probably damaging Het
Pcdhb14 T A 18: 37,449,482 V547E probably damaging Het
Pcdhb15 T C 18: 37,476,031 I772T possibly damaging Het
Pcnt T C 10: 76,408,796 Q1150R probably damaging Het
Pdcd6 A G 13: 74,305,581 I146T probably damaging Het
Phldb2 T A 16: 45,801,625 D664V probably damaging Het
Pik3ap1 A T 19: 41,332,234 V182E probably damaging Het
Pip4k2a A G 2: 18,847,622 V283A probably benign Het
Pnpla6 T C 8: 3,541,404 W1151R probably damaging Het
Ppp1r14c A G 10: 3,366,890 Y75C probably damaging Het
Prl2b1 C T 13: 27,383,469 D224N probably benign Het
Ptgis A G 2: 167,214,858 S270P probably benign Het
Rgs11 C A 17: 26,210,666 A446D probably damaging Het
Rims2 A G 15: 39,681,702 T1531A probably damaging Het
Sbno1 A T 5: 124,388,517 probably benign Het
Scarb2 C G 5: 92,448,557 M409I probably benign Het
Scube3 C T 17: 28,168,379 probably benign Het
Slc44a4 T C 17: 34,921,925 I180T probably damaging Het
Slc9a2 T C 1: 40,742,643 M344T probably damaging Het
Smc3 A T 19: 53,639,369 T860S probably benign Het
Snrpa A G 7: 27,191,749 I99T probably benign Het
Sorcs1 A G 19: 50,175,043 probably benign Het
Sorl1 C T 9: 41,991,482 probably null Het
Suds3 T C 5: 117,105,244 K143R probably benign Het
Supt20 A T 3: 54,714,743 M424L probably benign Het
Tgtp2 T C 11: 49,058,924 M274V probably benign Het
Tmem158 T A 9: 123,259,909 M213L probably benign Het
Tnks C A 8: 34,857,518 R639L probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt10c A C 16: 56,034,575 N232K possibly damaging Het
Trpm6 C T 19: 18,856,217 R1587W probably damaging Het
Trrap G A 5: 144,828,590 V2539I probably benign Het
Tsg101 A G 7: 46,907,087 S115P probably benign Het
Ttll13 G T 7: 80,260,508 V800L probably benign Het
Vmn1r57 A G 7: 5,220,577 T34A possibly damaging Het
Vmn2r118 T A 17: 55,611,530 T121S probably benign Het
Wdr35 A G 12: 8,985,772 I238M possibly damaging Het
Wisp2 G A 2: 163,828,986 V138M probably damaging Het
Zfp81 T A 17: 33,335,106 T245S probably benign Het
Zfyve26 G T 12: 79,278,463 P824Q probably damaging Het
Other mutations in Pkdrej
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pkdrej APN 15 85817226 missense probably damaging 1.00
IGL00981:Pkdrej APN 15 85819656 missense probably damaging 1.00
IGL01066:Pkdrej APN 15 85816159 missense probably benign 0.22
IGL01461:Pkdrej APN 15 85820374 missense possibly damaging 0.77
IGL01514:Pkdrej APN 15 85818063 missense possibly damaging 0.82
IGL01606:Pkdrej APN 15 85817700 missense possibly damaging 0.67
IGL01836:Pkdrej APN 15 85820958 missense probably damaging 1.00
IGL02089:Pkdrej APN 15 85816288 missense possibly damaging 0.87
IGL02197:Pkdrej APN 15 85815793 missense possibly damaging 0.89
IGL02331:Pkdrej APN 15 85821327 missense probably damaging 1.00
IGL02559:Pkdrej APN 15 85817848 missense probably benign
IGL02708:Pkdrej APN 15 85820787 missense probably damaging 1.00
IGL02739:Pkdrej APN 15 85819694 missense probably benign 0.41
IGL02741:Pkdrej APN 15 85817430 missense probably benign 0.04
IGL02882:Pkdrej APN 15 85817296 missense probably damaging 1.00
IGL02968:Pkdrej APN 15 85816181 nonsense probably null
IGL03250:Pkdrej APN 15 85821355 missense possibly damaging 0.92
FR4548:Pkdrej UTSW 15 85819680 small insertion probably benign
FR4737:Pkdrej UTSW 15 85819680 small insertion probably benign
PIT1430001:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
PIT4280001:Pkdrej UTSW 15 85819935 missense probably benign 0.01
R0004:Pkdrej UTSW 15 85818183 missense probably damaging 1.00
R0116:Pkdrej UTSW 15 85817545 nonsense probably null
R0117:Pkdrej UTSW 15 85816099 unclassified probably null
R0137:Pkdrej UTSW 15 85821567 missense possibly damaging 0.95
R0141:Pkdrej UTSW 15 85815630 missense probably damaging 0.99
R0325:Pkdrej UTSW 15 85819551 missense probably benign 0.08
R0714:Pkdrej UTSW 15 85815511 missense possibly damaging 0.85
R0749:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0750:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0755:Pkdrej UTSW 15 85816135 missense probably benign 0.00
R0938:Pkdrej UTSW 15 85818163 missense probably damaging 1.00
R1126:Pkdrej UTSW 15 85816314 missense probably damaging 0.99
R1204:Pkdrej UTSW 15 85818312 missense probably damaging 1.00
R1353:Pkdrej UTSW 15 85818918 missense probably damaging 1.00
R1471:Pkdrej UTSW 15 85817133 missense probably benign 0.37
R1510:Pkdrej UTSW 15 85816762 missense possibly damaging 0.61
R1573:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R1588:Pkdrej UTSW 15 85817241 missense probably benign 0.44
R1739:Pkdrej UTSW 15 85820427 missense probably benign 0.03
R1781:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1828:Pkdrej UTSW 15 85819282 missense possibly damaging 0.48
R1865:Pkdrej UTSW 15 85820324 nonsense probably null
R1870:Pkdrej UTSW 15 85816431 missense probably damaging 1.00
R1937:Pkdrej UTSW 15 85819167 missense probably benign 0.00
R2069:Pkdrej UTSW 15 85821231 missense probably benign 0.01
R2113:Pkdrej UTSW 15 85818984 missense probably damaging 1.00
R2135:Pkdrej UTSW 15 85816506 missense probably damaging 1.00
R2428:Pkdrej UTSW 15 85817572 nonsense probably null
R2991:Pkdrej UTSW 15 85819936 missense probably benign 0.00
R3029:Pkdrej UTSW 15 85817004 missense probably benign 0.16
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3747:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3748:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3749:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R4028:Pkdrej UTSW 15 85817492 missense probably benign 0.02
R4169:Pkdrej UTSW 15 85816314 missense probably benign 0.24
R4241:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4242:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4705:Pkdrej UTSW 15 85821167 nonsense probably null
R4939:Pkdrej UTSW 15 85820283 missense possibly damaging 0.82
R4954:Pkdrej UTSW 15 85816401 missense probably damaging 0.99
R4974:Pkdrej UTSW 15 85820409 missense probably benign 0.00
R4982:Pkdrej UTSW 15 85818996 missense probably damaging 0.99
R5105:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R5270:Pkdrej UTSW 15 85818327 missense probably damaging 1.00
R5296:Pkdrej UTSW 15 85817118 missense possibly damaging 0.67
R5631:Pkdrej UTSW 15 85820437 missense probably benign
R5909:Pkdrej UTSW 15 85818296 missense possibly damaging 0.82
R5998:Pkdrej UTSW 15 85815453 missense probably benign 0.01
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6125:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R6270:Pkdrej UTSW 15 85821105 nonsense probably null
R6500:Pkdrej UTSW 15 85819546 missense probably damaging 0.98
R6776:Pkdrej UTSW 15 85817309 nonsense probably null
R6786:Pkdrej UTSW 15 85818649 missense probably benign
R6866:Pkdrej UTSW 15 85820881 missense probably damaging 1.00
R6954:Pkdrej UTSW 15 85817853 nonsense probably null
R7086:Pkdrej UTSW 15 85820116 missense probably damaging 1.00
R7231:Pkdrej UTSW 15 85816188 missense possibly damaging 0.55
R7233:Pkdrej UTSW 15 85821148 missense probably damaging 0.96
R7289:Pkdrej UTSW 15 85821100 missense probably benign
R7549:Pkdrej UTSW 15 85819793 missense probably damaging 1.00
R7582:Pkdrej UTSW 15 85818921 missense possibly damaging 0.92
R7677:Pkdrej UTSW 15 85815587 missense probably benign 0.01
R7791:Pkdrej UTSW 15 85815931 missense possibly damaging 0.87
R7873:Pkdrej UTSW 15 85816523 missense probably benign 0.29
R7956:Pkdrej UTSW 15 85816523 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GGTCGTAGGACATGCTTCCATTCAG -3'
(R):5'- TCATGCAGCCAGTGAAGATCAACAG -3'

Sequencing Primer
(F):5'- GGACATGCTTCCATTCAGAATCAG -3'
(R):5'- CCTTATCCTGAGCAGAGACGAG -3'
Posted On2014-05-23