Incidental Mutation 'R0083:Sulf1'
ID19739
Institutional Source Beutler Lab
Gene Symbol Sulf1
Ensembl Gene ENSMUSG00000016918
Gene Namesulfatase 1
Synonyms
MMRRC Submission 038370-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R0083 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location12692277-12861192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12817417 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 272 (M272V)
Ref Sequence ENSEMBL: ENSMUSP00000141153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088585] [ENSMUST00000177608] [ENSMUST00000180062] [ENSMUST00000186051]
Predicted Effect probably benign
Transcript: ENSMUST00000088585
AA Change: M272V

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000085949
Gene: ENSMUSG00000016918
AA Change: M272V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177608
AA Change: M272V

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137523
Gene: ENSMUSG00000016918
AA Change: M272V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 534 678 9.7e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180062
AA Change: M272V

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136014
Gene: ENSMUSG00000016918
AA Change: M272V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186051
AA Change: M272V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141153
Gene: ENSMUSG00000016918
AA Change: M272V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.4e-56 PFAM
Pfam:Phosphodiest 61 323 9.6e-8 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 1.1e-48 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187376
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a null allele display a slight increase in mortality early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Ccdc88a T A 11: 29,503,463 S337T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col22a1 A T 15: 71,890,497 D104E possibly damaging Het
Col4a4 T C 1: 82,507,111 probably null Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fbxw10 A G 11: 62,877,061 T903A probably benign Het
Fkbp4 G A 6: 128,432,407 probably benign Het
Gatad2b T A 3: 90,357,943 Y576N probably damaging Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Myh14 A G 7: 44,634,519 V654A probably damaging Het
Neu2 A G 1: 87,597,262 Y323C probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Olfr1491 A T 19: 13,705,678 T284S probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sap130 C A 18: 31,666,329 probably benign Het
Sap130 C T 18: 31,711,641 P902S probably damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slc30a5 G T 13: 100,803,400 A669E probably damaging Het
Sppl2c G A 11: 104,186,532 V53I probably benign Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Sulf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Sulf1 APN 1 12820463 missense probably damaging 0.99
IGL00788:Sulf1 APN 1 12848449 missense probably damaging 0.99
IGL00845:Sulf1 APN 1 12796967 missense probably damaging 1.00
IGL01606:Sulf1 APN 1 12836204 missense possibly damaging 0.87
IGL01963:Sulf1 APN 1 12818507 missense probably damaging 1.00
IGL01968:Sulf1 APN 1 12818451 missense probably damaging 1.00
IGL02072:Sulf1 APN 1 12848208 missense probably damaging 1.00
IGL02424:Sulf1 APN 1 12796840 missense probably benign 0.28
IGL02519:Sulf1 APN 1 12838363 nonsense probably null
IGL02601:Sulf1 APN 1 12786645 missense probably damaging 1.00
IGL03066:Sulf1 APN 1 12807944 missense probably damaging 0.99
IGL03200:Sulf1 APN 1 12786617 nonsense probably null
PIT4480001:Sulf1 UTSW 1 12859413 missense probably benign 0.01
PIT4519001:Sulf1 UTSW 1 12848171 missense probably damaging 1.00
R0467:Sulf1 UTSW 1 12796920 missense probably damaging 1.00
R0554:Sulf1 UTSW 1 12805194 missense probably damaging 1.00
R0626:Sulf1 UTSW 1 12817492 splice site probably null
R1083:Sulf1 UTSW 1 12836164 frame shift probably null
R1084:Sulf1 UTSW 1 12836164 frame shift probably null
R1498:Sulf1 UTSW 1 12848350 missense probably damaging 1.00
R1523:Sulf1 UTSW 1 12817350 nonsense probably null
R1854:Sulf1 UTSW 1 12838437 missense probably benign 0.06
R1942:Sulf1 UTSW 1 12848173 missense probably damaging 1.00
R1946:Sulf1 UTSW 1 12796907 missense probably benign 0.04
R1998:Sulf1 UTSW 1 12858834 nonsense probably null
R2034:Sulf1 UTSW 1 12820421 missense probably damaging 1.00
R2068:Sulf1 UTSW 1 12840403 missense probably damaging 1.00
R2113:Sulf1 UTSW 1 12848174 missense probably damaging 0.99
R2277:Sulf1 UTSW 1 12796794 missense probably benign 0.41
R3827:Sulf1 UTSW 1 12817432 missense probably benign
R3874:Sulf1 UTSW 1 12817412 missense probably damaging 1.00
R4488:Sulf1 UTSW 1 12786515 start gained probably benign
R4619:Sulf1 UTSW 1 12786652 missense probably damaging 1.00
R4743:Sulf1 UTSW 1 12836293 missense probably benign 0.04
R4836:Sulf1 UTSW 1 12842686 missense probably benign 0.02
R4918:Sulf1 UTSW 1 12818496 missense probably damaging 1.00
R4958:Sulf1 UTSW 1 12796910 missense probably benign 0.08
R5216:Sulf1 UTSW 1 12796874 missense probably benign 0.28
R5225:Sulf1 UTSW 1 12841478 missense probably benign
R5427:Sulf1 UTSW 1 12796912 missense possibly damaging 0.84
R5450:Sulf1 UTSW 1 12796907 missense probably benign 0.04
R5909:Sulf1 UTSW 1 12858815 missense possibly damaging 0.94
R5912:Sulf1 UTSW 1 12786752 unclassified probably benign
R5966:Sulf1 UTSW 1 12859412 missense probably benign 0.06
R6339:Sulf1 UTSW 1 12838440 missense probably damaging 1.00
R6841:Sulf1 UTSW 1 12838434 missense probably damaging 1.00
R6880:Sulf1 UTSW 1 12842755 missense probably damaging 1.00
R7110:Sulf1 UTSW 1 12838601 missense probably damaging 1.00
R7255:Sulf1 UTSW 1 12859008 missense probably benign 0.00
R7386:Sulf1 UTSW 1 12838361 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCTTGGGAGAAGAACACTTCAGCAG -3'
(R):5'- CCAAAGCATTTGATGGTATGGACCCTG -3'

Sequencing Primer
(F):5'- ACACTTCAGCAGTGACTAAATTATC -3'
(R):5'- GTCACTGGCTCTTTTAGAAACAGG -3'
Posted On2013-04-11