Incidental Mutation 'R0083:Plcl1'
ID19740
Institutional Source Beutler Lab
Gene Symbol Plcl1
Ensembl Gene ENSMUSG00000038349
Gene Namephospholipase C-like 1
SynonymsPRIP-1, C230017K02Rik, PLC-L
MMRRC Submission 038370-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R0083 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location55405921-55754285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55697939 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 813 (Y813C)
Ref Sequence ENSEMBL: ENSMUSP00000037854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042986]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042986
AA Change: Y813C

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037854
Gene: ENSMUSG00000038349
AA Change: Y813C

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
PH 115 226 6.98e-4 SMART
low complexity region 301 310 N/A INTRINSIC
Pfam:EF-hand_like 316 398 5.9e-27 PFAM
PLCXc 399 543 2.13e-82 SMART
low complexity region 550 564 N/A INTRINSIC
PLCYc 586 702 2.15e-69 SMART
C2 723 829 1.02e-21 SMART
low complexity region 1080 1092 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187059
Meta Mutation Damage Score 0.5540 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
MGI Phenotype PHENOTYPE: Homozygous null mutants display impaired motor coordination and decreased sensitivity to the sedative diazepam. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Ccdc88a T A 11: 29,503,463 S337T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col22a1 A T 15: 71,890,497 D104E possibly damaging Het
Col4a4 T C 1: 82,507,111 probably null Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fbxw10 A G 11: 62,877,061 T903A probably benign Het
Fkbp4 G A 6: 128,432,407 probably benign Het
Gatad2b T A 3: 90,357,943 Y576N probably damaging Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Myh14 A G 7: 44,634,519 V654A probably damaging Het
Neu2 A G 1: 87,597,262 Y323C probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Olfr1491 A T 19: 13,705,678 T284S probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sap130 C A 18: 31,666,329 probably benign Het
Sap130 C T 18: 31,711,641 P902S probably damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slc30a5 G T 13: 100,803,400 A669E probably damaging Het
Sppl2c G A 11: 104,186,532 V53I probably benign Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Sulf1 A G 1: 12,817,417 M272V probably damaging Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Plcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Plcl1 APN 1 55406536 missense probably benign
IGL00491:Plcl1 APN 1 55713498 critical splice donor site probably null
IGL00753:Plcl1 APN 1 55696738 missense probably damaging 1.00
IGL01415:Plcl1 APN 1 55696396 missense possibly damaging 0.92
IGL03024:Plcl1 APN 1 55695787 missense probably damaging 1.00
K3955:Plcl1 UTSW 1 55697939 missense possibly damaging 0.78
PIT4791001:Plcl1 UTSW 1 55701931 missense probably benign 0.03
R0066:Plcl1 UTSW 1 55713475 missense probably damaging 0.99
R0066:Plcl1 UTSW 1 55713475 missense probably damaging 0.99
R0086:Plcl1 UTSW 1 55715583 missense probably damaging 1.00
R0092:Plcl1 UTSW 1 55696765 missense probably damaging 0.98
R0108:Plcl1 UTSW 1 55697939 missense possibly damaging 0.78
R1716:Plcl1 UTSW 1 55695838 missense probably damaging 0.99
R2061:Plcl1 UTSW 1 55751345 missense probably benign 0.01
R2128:Plcl1 UTSW 1 55697838 missense probably damaging 1.00
R2869:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2869:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2870:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2870:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2872:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2872:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2873:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R3819:Plcl1 UTSW 1 55696599 missense probably benign
R3974:Plcl1 UTSW 1 55698215 missense probably benign 0.30
R3975:Plcl1 UTSW 1 55698215 missense probably benign 0.30
R4214:Plcl1 UTSW 1 55751335 nonsense probably null
R4400:Plcl1 UTSW 1 55715577 missense probably damaging 1.00
R4452:Plcl1 UTSW 1 55696886 missense probably benign 0.00
R4615:Plcl1 UTSW 1 55698134 missense probably benign 0.00
R5060:Plcl1 UTSW 1 55696512 missense possibly damaging 0.84
R5422:Plcl1 UTSW 1 55697384 missense probably benign 0.00
R5568:Plcl1 UTSW 1 55696150 missense possibly damaging 0.82
R5781:Plcl1 UTSW 1 55695989 missense possibly damaging 0.92
R5809:Plcl1 UTSW 1 55696001 missense probably damaging 1.00
R6009:Plcl1 UTSW 1 55696246 missense probably damaging 1.00
R6339:Plcl1 UTSW 1 55696315 missense probably damaging 1.00
R6431:Plcl1 UTSW 1 55697252 missense probably benign 0.03
R6534:Plcl1 UTSW 1 55696748 missense probably damaging 1.00
R6565:Plcl1 UTSW 1 55697958 nonsense probably null
R6678:Plcl1 UTSW 1 55695776 missense probably benign 0.13
R6773:Plcl1 UTSW 1 55751302 missense probably benign 0.03
R6925:Plcl1 UTSW 1 55406598 nonsense probably null
R7168:Plcl1 UTSW 1 55697463 missense probably damaging 1.00
R7256:Plcl1 UTSW 1 55698218 missense probably benign 0.45
R7522:Plcl1 UTSW 1 55696364 missense probably benign 0.31
R7527:Plcl1 UTSW 1 55697114 missense probably damaging 1.00
R7536:Plcl1 UTSW 1 55713481 nonsense probably null
R7585:Plcl1 UTSW 1 55406449 missense probably benign 0.00
R7591:Plcl1 UTSW 1 55697449 missense probably benign 0.01
R7689:Plcl1 UTSW 1 55697468 missense probably damaging 1.00
R7960:Plcl1 UTSW 1 55697284 missense possibly damaging 0.48
R8029:Plcl1 UTSW 1 55696078 missense probably benign 0.26
R8241:Plcl1 UTSW 1 55695817 missense probably benign 0.01
R8323:Plcl1 UTSW 1 55697736 missense possibly damaging 0.58
Z1176:Plcl1 UTSW 1 55696040 missense probably benign 0.20
Z1176:Plcl1 UTSW 1 55751284 nonsense probably null
Z1177:Plcl1 UTSW 1 55696884 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GTGCCAAAGGGGATGTCATAGACC -3'
(R):5'- GGCTTCTCGTAAGGGATGAACTGC -3'

Sequencing Primer
(F):5'- CATAGACCCCTATGTTTGTGTGGAG -3'
(R):5'- GACCAATATTCCTGAGCATGGTG -3'
Posted On2013-04-11