Mutagenetix > Incidental Mutation

Incidental Mutation 'R0083:Plcl1'

19740

Institutional Source

Beutler Lab

Gene Symbol

Plcl1

Ensembl Gene

ENSMUSG00000038349

Gene Name

phospholipase C-like 1

Synonyms

PRIP-1, C230017K02Rik, PLC-L

MMRRC Submission

038370-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.910) question?

Stock #

R0083 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55405921-55754285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55697939 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 813 (Y813C)

Ref Sequence

ENSEMBL: ENSMUSP00000037854 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042986]

AlphaFold

Q3USB7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042986
AA Change: Y813C

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000037854
Gene: ENSMUSG00000038349
AA Change: Y813C

Domain	Start	End	E-Value	Type
low complexity region	21	41	N/A	INTRINSIC
low complexity region	49	60	N/A	INTRINSIC
PH	115	226	6.98e-4	SMART
low complexity region	301	310	N/A	INTRINSIC
Pfam:EF-hand_like	316	398	5.9e-27	PFAM
PLCXc	399	543	2.13e-82	SMART
low complexity region	550	564	N/A	INTRINSIC
PLCYc	586	702	2.15e-69	SMART
C2	723	829	1.02e-21	SMART
low complexity region	1080	1092	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187059

Meta Mutation Damage Score

0.5540

Coding Region Coverage

1x: 99.1%
3x: 97.8%
10x: 94.0%
20x: 83.1%

Validation Efficiency

88% (117/133)

MGI Phenotype

PHENOTYPE: Homozygous null mutants display impaired motor coordination and decreased sensitivity to the sedative diazepam. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	A	T	2: 85,494,132	F283L	possibly damaging	Het
4930562C15Rik	A	T	16: 4,849,542	I266F	unknown	Het
Adam39	T	G	8: 40,825,078	F169V	probably damaging	Het
Adcy2	A	T	13: 68,651,935	V858E	probably damaging	Het
Adgrv1	A	G	13: 81,578,404		probably benign	Het
Ankrd26	G	T	6: 118,523,254	H1085Q	probably benign	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
Atg4c	C	T	4: 99,221,440	H215Y	possibly damaging	Het
Atp6v0d2	G	A	4: 19,880,001		probably benign	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
C1qtnf3	G	A	15: 10,975,632	V175I	possibly damaging	Het
Cacna1c	A	G	6: 118,625,523	M1293T	probably damaging	Het
Ccdc88a	T	A	11: 29,503,463	S337T	probably damaging	Het
Cntn4	A	G	6: 106,525,369	I362M	possibly damaging	Het
Col22a1	A	T	15: 71,890,497	D104E	possibly damaging	Het
Col4a4	T	C	1: 82,507,111		probably null	Het
Cul7	C	A	17: 46,655,556	R304S	probably benign	Het
Elfn2	A	T	15: 78,673,414	L311Q	probably damaging	Het
Esrrb	T	C	12: 86,514,452	L320P	probably damaging	Het
Fbxw10	A	G	11: 62,877,061	T903A	probably benign	Het
Fkbp4	G	A	6: 128,432,407		probably benign	Het
Gatad2b	T	A	3: 90,357,943	Y576N	probably damaging	Het
Greb1	T	C	12: 16,696,451	M1273V	probably benign	Het
Helq	C	A	5: 100,768,368	E913*	probably null	Het
Inpp4b	C	A	8: 81,741,462	A18E	possibly damaging	Het
Ints13	A	G	6: 146,550,664	Y686H	probably benign	Het
Itgb7	C	T	15: 102,223,482	R222H	probably damaging	Het
Krt81	A	G	15: 101,463,465	I78T	probably damaging	Het
Lonp2	G	A	8: 86,716,355	V815I	probably benign	Het
Mctp2	G	T	7: 72,228,516	F271L	possibly damaging	Het
Mrto4	C	T	4: 139,347,968	V175I	possibly damaging	Het
Myh14	A	G	7: 44,634,519	V654A	probably damaging	Het
Neu2	A	G	1: 87,597,262	Y323C	probably damaging	Het
Nt5dc1	A	C	10: 34,403,764	M94R	probably damaging	Het
Nup210l	A	G	3: 90,189,575	T1364A	probably damaging	Het
Obscn	T	C	11: 59,022,374	D6939G	probably damaging	Het
Olfr1491	A	T	19: 13,705,678	T284S	probably damaging	Het
Pias4	A	G	10: 81,164,166	S18P	probably damaging	Het
Plk5	G	A	10: 80,356,662	G34S	possibly damaging	Het
Ptprj	A	T	2: 90,469,777		probably null	Het
Rps6ka2	G	A	17: 7,296,043	D617N	probably benign	Het
Sap130	C	A	18: 31,666,329		probably benign	Het
Sap130	C	T	18: 31,711,641	P902S	probably damaging	Het
Sec11a	A	G	7: 80,935,039	V50A	probably damaging	Het
Sel1l3	C	T	5: 53,137,902	A786T	possibly damaging	Het
Shroom1	T	C	11: 53,466,937	S772P	possibly damaging	Het
Slc15a2	T	C	16: 36,782,283	Y72C	probably damaging	Het
Slc26a6	T	C	9: 108,859,113		probably null	Het
Slc30a5	G	T	13: 100,803,400	A669E	probably damaging	Het
Sppl2c	G	A	11: 104,186,532	V53I	probably benign	Het
Sstr1	T	A	12: 58,213,742	C384S	possibly damaging	Het
Sulf1	A	G	1: 12,817,417	M272V	probably damaging	Het
Tm6sf1	G	A	7: 81,865,345		probably null	Het
Tmem94	A	G	11: 115,796,724		probably benign	Het
Topaz1	A	T	9: 122,775,609	I1093L	probably benign	Het
Ttll4	G	T	1: 74,679,769	V260L	probably benign	Het
Vmn2r26	A	T	6: 124,053,981		probably null	Het
Vmn2r75	G	A	7: 86,165,658	A209V	probably benign	Het
Zfand3	A	G	17: 30,135,398	E63G	probably damaging	Het
Zfp939	A	T	7: 39,474,110		noncoding transcript	Het

Other mutations in Plcl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Plcl1	APN	1	55406536	missense	probably benign
IGL00491:Plcl1	APN	1	55713498	critical splice donor site	probably null
IGL00753:Plcl1	APN	1	55696738	missense	probably damaging	1.00
IGL01415:Plcl1	APN	1	55696396	missense	possibly damaging	0.92
IGL03024:Plcl1	APN	1	55695787	missense	probably damaging	1.00
K3955:Plcl1	UTSW	1	55697939	missense	possibly damaging	0.78
PIT4791001:Plcl1	UTSW	1	55701931	missense	probably benign	0.03
R0066:Plcl1	UTSW	1	55713475	missense	probably damaging	0.99
R0066:Plcl1	UTSW	1	55713475	missense	probably damaging	0.99
R0086:Plcl1	UTSW	1	55715583	missense	probably damaging	1.00
R0092:Plcl1	UTSW	1	55696765	missense	probably damaging	0.98
R0108:Plcl1	UTSW	1	55697939	missense	possibly damaging	0.78
R1716:Plcl1	UTSW	1	55695838	missense	probably damaging	0.99
R2061:Plcl1	UTSW	1	55751345	missense	probably benign	0.01
R2128:Plcl1	UTSW	1	55697838	missense	probably damaging	1.00
R2869:Plcl1	UTSW	1	55697150	missense	probably benign	0.09
R2869:Plcl1	UTSW	1	55697150	missense	probably benign	0.09
R2870:Plcl1	UTSW	1	55697150	missense	probably benign	0.09
R2870:Plcl1	UTSW	1	55697150	missense	probably benign	0.09
R2872:Plcl1	UTSW	1	55697150	missense	probably benign	0.09
R2872:Plcl1	UTSW	1	55697150	missense	probably benign	0.09
R2873:Plcl1	UTSW	1	55697150	missense	probably benign	0.09
R3819:Plcl1	UTSW	1	55696599	missense	probably benign
R3974:Plcl1	UTSW	1	55698215	missense	probably benign	0.30
R3975:Plcl1	UTSW	1	55698215	missense	probably benign	0.30
R4214:Plcl1	UTSW	1	55751335	nonsense	probably null
R4400:Plcl1	UTSW	1	55715577	missense	probably damaging	1.00
R4452:Plcl1	UTSW	1	55696886	missense	probably benign	0.00
R4615:Plcl1	UTSW	1	55698134	missense	probably benign	0.00
R5060:Plcl1	UTSW	1	55696512	missense	possibly damaging	0.84
R5422:Plcl1	UTSW	1	55697384	missense	probably benign	0.00
R5568:Plcl1	UTSW	1	55696150	missense	possibly damaging	0.82
R5781:Plcl1	UTSW	1	55695989	missense	possibly damaging	0.92
R5809:Plcl1	UTSW	1	55696001	missense	probably damaging	1.00
R6009:Plcl1	UTSW	1	55696246	missense	probably damaging	1.00
R6339:Plcl1	UTSW	1	55696315	missense	probably damaging	1.00
R6431:Plcl1	UTSW	1	55697252	missense	probably benign	0.03
R6534:Plcl1	UTSW	1	55696748	missense	probably damaging	1.00
R6565:Plcl1	UTSW	1	55697958	nonsense	probably null
R6678:Plcl1	UTSW	1	55695776	missense	probably benign	0.13
R6773:Plcl1	UTSW	1	55751302	missense	probably benign	0.03
R6925:Plcl1	UTSW	1	55406598	nonsense	probably null
R7168:Plcl1	UTSW	1	55697463	missense	probably damaging	1.00
R7256:Plcl1	UTSW	1	55698218	missense	probably benign	0.45
R7522:Plcl1	UTSW	1	55696364	missense	probably benign	0.31
R7527:Plcl1	UTSW	1	55697114	missense	probably damaging	1.00
R7536:Plcl1	UTSW	1	55713481	nonsense	probably null
R7585:Plcl1	UTSW	1	55406449	missense	probably benign	0.00
R7591:Plcl1	UTSW	1	55697449	missense	probably benign	0.01
R7689:Plcl1	UTSW	1	55697468	missense	probably damaging	1.00
R7960:Plcl1	UTSW	1	55697284	missense	possibly damaging	0.48
R8029:Plcl1	UTSW	1	55696078	missense	probably benign	0.26
R8241:Plcl1	UTSW	1	55695817	missense	probably benign	0.01
R8323:Plcl1	UTSW	1	55697736	missense	possibly damaging	0.58
R9000:Plcl1	UTSW	1	55697831	missense	probably damaging	1.00
R9331:Plcl1	UTSW	1	55696871	missense	possibly damaging	0.95
R9358:Plcl1	UTSW	1	55696651	missense	probably damaging	1.00
R9432:Plcl1	UTSW	1	55406428	missense	probably benign
R9452:Plcl1	UTSW	1	55695833	missense	probably damaging	1.00
R9652:Plcl1	UTSW	1	55696291	missense	probably benign	0.00
R9802:Plcl1	UTSW	1	55696082	missense	probably damaging	0.98
Z1176:Plcl1	UTSW	1	55696040	missense	probably benign	0.20
Z1176:Plcl1	UTSW	1	55751284	nonsense	probably null
Z1177:Plcl1	UTSW	1	55696884	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- GTGCCAAAGGGGATGTCATAGACC -3'
(R):5'- GGCTTCTCGTAAGGGATGAACTGC -3'

Sequencing Primer
(F):5'- CATAGACCCCTATGTTTGTGTGGAG -3'
(R):5'- GACCAATATTCCTGAGCATGGTG -3'

Posted On

2013-04-11