Incidental Mutation 'R1779:Trpm6'
ID 197406
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Name transient receptor potential cation channel, subfamily M, member 6
Synonyms CHAK2
MMRRC Submission 039810-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1779 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 18727347-18869875 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 18833581 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 1587 (R1587W)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
AlphaFold Q8CIR4
Predicted Effect probably damaging
Transcript: ENSMUST00000040489
AA Change: R1587W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: R1587W

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T G 3: 124,200,163 (GRCm39) L476F probably damaging Het
4930432E11Rik A T 7: 29,278,591 (GRCm39) noncoding transcript Het
A930011G23Rik A T 5: 99,370,897 (GRCm39) probably benign Het
Abcd3 A G 3: 121,575,612 (GRCm39) Y217H probably damaging Het
Abraxas1 A T 5: 100,965,822 (GRCm39) probably benign Het
Acsbg1 T C 9: 54,523,346 (GRCm39) Y427C probably damaging Het
Acsbg3 T A 17: 57,192,169 (GRCm39) Y577* probably null Het
Adam10 T A 9: 70,683,651 (GRCm39) probably benign Het
Adam24 G A 8: 41,134,004 (GRCm39) V491I possibly damaging Het
Adamts2 T G 11: 50,647,524 (GRCm39) V299G probably damaging Het
Adh7 A G 3: 137,929,752 (GRCm39) T143A probably damaging Het
Ahcyl1 A G 3: 107,581,419 (GRCm39) S81P probably benign Het
Arhgap20 C A 9: 51,761,215 (GRCm39) T986K probably benign Het
Atp13a5 A T 16: 29,133,478 (GRCm39) I391N possibly damaging Het
Atp6v0a1 C A 11: 100,917,511 (GRCm39) A143E probably benign Het
Calcrl A G 2: 84,181,629 (GRCm39) I173T probably damaging Het
Casz1 A G 4: 149,017,394 (GRCm39) T228A probably benign Het
Cckar A G 5: 53,857,321 (GRCm39) I292T probably damaging Het
Ccn5 G A 2: 163,670,906 (GRCm39) V138M probably damaging Het
Cfhr2 T A 1: 139,786,383 (GRCm39) probably null Het
Chkb T C 15: 89,313,260 (GRCm39) I109V possibly damaging Het
Clec2i T C 6: 128,865,069 (GRCm39) probably null Het
Clec4a4 T A 6: 123,000,934 (GRCm39) W216R probably damaging Het
Cntnap1 A C 11: 101,077,337 (GRCm39) I1000L probably damaging Het
Cp C A 3: 20,011,549 (GRCm39) D34E possibly damaging Het
Cse1l T C 2: 166,782,044 (GRCm39) probably null Het
Dennd3 T C 15: 73,394,357 (GRCm39) probably null Het
Dnah7a A G 1: 53,616,382 (GRCm39) V1193A probably benign Het
Eaf2 A G 16: 36,630,832 (GRCm39) probably null Het
Efcab3 T A 11: 104,611,765 (GRCm39) S536T probably benign Het
Ephb2 T C 4: 136,421,136 (GRCm39) T405A possibly damaging Het
Fam117a G A 11: 95,269,779 (GRCm39) V348M probably damaging Het
Fh1 T C 1: 175,428,990 (GRCm39) *167W probably null Het
Fmo9 T A 1: 166,490,868 (GRCm39) I486F probably benign Het
Gabbr1 T A 17: 37,365,771 (GRCm39) I150N probably damaging Het
Gfpt1 T C 6: 87,054,179 (GRCm39) V478A possibly damaging Het
Gm2663 A T 6: 40,974,894 (GRCm39) V59E probably damaging Het
Gm4868 T A 5: 125,925,176 (GRCm39) noncoding transcript Het
Heatr4 T A 12: 84,026,934 (GRCm39) T108S probably benign Het
Hells G T 19: 38,935,286 (GRCm39) A319S probably benign Het
Helz2 A G 2: 180,876,780 (GRCm39) V1238A probably benign Het
Helz2 T A 2: 180,880,252 (GRCm39) Q488L possibly damaging Het
Hkdc1 A G 10: 62,227,162 (GRCm39) F765S probably damaging Het
Hspg2 T A 4: 137,245,820 (GRCm39) W938R probably damaging Het
Itpr2 G A 6: 146,060,399 (GRCm39) R2473* probably null Het
Kctd1 C T 18: 15,194,839 (GRCm39) V595I probably benign Het
Krt7 A G 15: 101,321,290 (GRCm39) Y369C probably damaging Het
Krt72 T C 15: 101,689,364 (GRCm39) T323A probably benign Het
Krt76 A G 15: 101,801,122 (GRCm39) L58P unknown Het
Liph C A 16: 21,786,800 (GRCm39) R272L probably benign Het
Lrrc9 A T 12: 72,502,772 (GRCm39) K248* probably null Het
Mei4 T A 9: 81,809,195 (GRCm39) S93T probably damaging Het
Mgll T A 6: 88,790,930 (GRCm39) Y183* probably null Het
Myo5b A G 18: 74,875,218 (GRCm39) M1541V probably benign Het
Napg A G 18: 63,115,762 (GRCm39) E66G probably benign Het
Npr3 T C 15: 11,851,572 (GRCm39) D406G probably damaging Het
Nr2c2 A G 6: 92,136,224 (GRCm39) T355A possibly damaging Het
Or13j1 G A 4: 43,706,041 (GRCm39) H176Y probably damaging Het
Or4a71 A T 2: 89,357,989 (GRCm39) I255K probably benign Het
Or51m1 G T 7: 103,578,668 (GRCm39) V213L probably benign Het
Or51v8 A G 7: 103,319,845 (GRCm39) I131T probably benign Het
Or52z13 A T 7: 103,247,107 (GRCm39) I195F probably damaging Het
Or5b107 T C 19: 13,142,404 (GRCm39) Y9H probably benign Het
Or8d1 A G 9: 38,766,846 (GRCm39) M163V possibly damaging Het
Orai2 T C 5: 136,179,793 (GRCm39) E80G probably damaging Het
Pcdhb14 T A 18: 37,582,535 (GRCm39) V547E probably damaging Het
Pcdhb15 T C 18: 37,609,084 (GRCm39) I772T possibly damaging Het
Pcnt T C 10: 76,244,630 (GRCm39) Q1150R probably damaging Het
Pdcd6 A G 13: 74,453,700 (GRCm39) I146T probably damaging Het
Phldb2 T A 16: 45,621,988 (GRCm39) D664V probably damaging Het
Pik3ap1 A T 19: 41,320,673 (GRCm39) V182E probably damaging Het
Pip4k2a A G 2: 18,852,433 (GRCm39) V283A probably benign Het
Pkdrej A G 15: 85,705,372 (GRCm39) V188A possibly damaging Het
Pnpla6 T C 8: 3,591,404 (GRCm39) W1151R probably damaging Het
Ppp1r14c A G 10: 3,316,890 (GRCm39) Y75C probably damaging Het
Prl2b1 C T 13: 27,567,452 (GRCm39) D224N probably benign Het
Ptgis A G 2: 167,056,778 (GRCm39) S270P probably benign Het
Rgs11 C A 17: 26,429,640 (GRCm39) A446D probably damaging Het
Rims2 A G 15: 39,545,098 (GRCm39) T1531A probably damaging Het
Sbno1 A T 5: 124,526,580 (GRCm39) probably benign Het
Scarb2 C G 5: 92,596,416 (GRCm39) M409I probably benign Het
Scube3 C T 17: 28,387,353 (GRCm39) probably benign Het
Slc44a4 T C 17: 35,140,901 (GRCm39) I180T probably damaging Het
Slc9a2 T C 1: 40,781,803 (GRCm39) M344T probably damaging Het
Smc3 A T 19: 53,627,800 (GRCm39) T860S probably benign Het
Snrpa A G 7: 26,891,174 (GRCm39) I99T probably benign Het
Sorcs1 A G 19: 50,163,481 (GRCm39) probably benign Het
Sorl1 C T 9: 41,902,778 (GRCm39) probably null Het
Suds3 T C 5: 117,243,309 (GRCm39) K143R probably benign Het
Supt20 A T 3: 54,622,164 (GRCm39) M424L probably benign Het
Tgtp2 T C 11: 48,949,751 (GRCm39) M274V probably benign Het
Tmem158 T A 9: 123,088,974 (GRCm39) M213L probably benign Het
Tnks C A 8: 35,324,672 (GRCm39) R639L probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trmt10c A C 16: 55,854,938 (GRCm39) N232K possibly damaging Het
Trrap G A 5: 144,765,400 (GRCm39) V2539I probably benign Het
Tsg101 A G 7: 46,556,835 (GRCm39) S115P probably benign Het
Ttll13 G T 7: 79,910,256 (GRCm39) V800L probably benign Het
Vmn1r57 A G 7: 5,223,576 (GRCm39) T34A possibly damaging Het
Vmn2r118 T A 17: 55,918,530 (GRCm39) T121S probably benign Het
Wdr35 A G 12: 9,035,772 (GRCm39) I238M possibly damaging Het
Zfp81 T A 17: 33,554,080 (GRCm39) T245S probably benign Het
Zfyve26 G T 12: 79,325,237 (GRCm39) P824Q probably damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18,761,272 (GRCm39) splice site probably benign
IGL00862:Trpm6 APN 19 18,804,892 (GRCm39) missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18,855,015 (GRCm39) missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18,803,158 (GRCm39) nonsense probably null
IGL01451:Trpm6 APN 19 18,786,933 (GRCm39) missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18,773,894 (GRCm39) nonsense probably null
IGL01995:Trpm6 APN 19 18,807,691 (GRCm39) splice site probably benign
IGL02092:Trpm6 APN 19 18,749,695 (GRCm39) missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18,809,903 (GRCm39) missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18,831,427 (GRCm39) missense probably benign
IGL02329:Trpm6 APN 19 18,831,581 (GRCm39) missense probably benign 0.17
IGL02366:Trpm6 APN 19 18,755,874 (GRCm39) splice site probably benign
IGL02402:Trpm6 APN 19 18,764,120 (GRCm39) missense probably benign 0.18
IGL02457:Trpm6 APN 19 18,804,762 (GRCm39) nonsense probably null
IGL02457:Trpm6 APN 19 18,803,155 (GRCm39) missense probably damaging 1.00
IGL02684:Trpm6 APN 19 18,779,571 (GRCm39) splice site probably benign
IGL02705:Trpm6 APN 19 18,754,097 (GRCm39) critical splice donor site probably null
IGL02728:Trpm6 APN 19 18,787,016 (GRCm39) missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18,807,376 (GRCm39) splice site probably benign
IGL02818:Trpm6 APN 19 18,843,621 (GRCm39) missense probably benign 0.04
IGL02836:Trpm6 APN 19 18,790,846 (GRCm39) missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18,815,381 (GRCm39) nonsense probably null
IGL03193:Trpm6 APN 19 18,803,236 (GRCm39) missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18,764,143 (GRCm39) missense probably benign 0.12
IGL03227:Trpm6 APN 19 18,796,483 (GRCm39) missense probably benign 0.01
IGL03231:Trpm6 APN 19 18,796,545 (GRCm39) missense probably benign
IGL03245:Trpm6 APN 19 18,855,065 (GRCm39) missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18,815,446 (GRCm39) missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18,790,850 (GRCm39) missense probably benign
P0043:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18,803,166 (GRCm39) missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18,764,119 (GRCm39) missense probably benign 0.05
R0115:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18,809,957 (GRCm39) missense probably benign 0.05
R0140:Trpm6 UTSW 19 18,796,558 (GRCm39) splice site probably null
R0267:Trpm6 UTSW 19 18,800,742 (GRCm39) missense probably benign
R0350:Trpm6 UTSW 19 18,861,321 (GRCm39) splice site probably null
R0373:Trpm6 UTSW 19 18,830,951 (GRCm39) missense probably benign 0.15
R0393:Trpm6 UTSW 19 18,756,008 (GRCm39) missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18,760,389 (GRCm39) splice site probably benign
R0505:Trpm6 UTSW 19 18,851,266 (GRCm39) splice site probably benign
R0526:Trpm6 UTSW 19 18,770,240 (GRCm39) missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18,849,585 (GRCm39) missense probably benign 0.00
R0609:Trpm6 UTSW 19 18,803,226 (GRCm39) missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18,815,451 (GRCm39) missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18,773,862 (GRCm39) missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18,773,859 (GRCm39) missense probably benign 0.28
R1512:Trpm6 UTSW 19 18,853,295 (GRCm39) missense probably benign
R1558:Trpm6 UTSW 19 18,764,192 (GRCm39) missense probably benign 0.04
R1597:Trpm6 UTSW 19 18,804,888 (GRCm39) missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18,854,995 (GRCm39) missense possibly damaging 0.88
R1796:Trpm6 UTSW 19 18,804,931 (GRCm39) missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18,869,363 (GRCm39) splice site probably null
R1840:Trpm6 UTSW 19 18,843,631 (GRCm39) missense probably benign 0.21
R1991:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2030:Trpm6 UTSW 19 18,831,629 (GRCm39) missense probably benign
R2073:Trpm6 UTSW 19 18,853,406 (GRCm39) missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18,855,103 (GRCm39) missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18,803,116 (GRCm39) missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2106:Trpm6 UTSW 19 18,790,714 (GRCm39) missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18,769,454 (GRCm39) missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18,831,795 (GRCm39) missense probably benign 0.05
R3719:Trpm6 UTSW 19 18,749,757 (GRCm39) nonsense probably null
R3779:Trpm6 UTSW 19 18,853,403 (GRCm39) missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18,809,921 (GRCm39) missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18,804,889 (GRCm39) missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18,773,864 (GRCm39) missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18,809,841 (GRCm39) missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18,809,961 (GRCm39) missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18,803,236 (GRCm39) missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R4714:Trpm6 UTSW 19 18,831,564 (GRCm39) missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18,853,428 (GRCm39) missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18,790,857 (GRCm39) missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18,845,345 (GRCm39) missense probably benign 0.00
R4814:Trpm6 UTSW 19 18,839,576 (GRCm39) missense probably benign 0.11
R5028:Trpm6 UTSW 19 18,764,124 (GRCm39) missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18,790,828 (GRCm39) missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18,807,297 (GRCm39) missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18,807,571 (GRCm39) missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18,830,968 (GRCm39) missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18,830,981 (GRCm39) missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18,764,183 (GRCm39) missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18,833,539 (GRCm39) missense probably benign 0.04
R5955:Trpm6 UTSW 19 18,869,383 (GRCm39) missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6105:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6211:Trpm6 UTSW 19 18,760,492 (GRCm39) missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18,831,655 (GRCm39) missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18,831,472 (GRCm39) missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18,807,354 (GRCm39) missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18,815,406 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,866,384 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,773,803 (GRCm39) critical splice acceptor site probably null
R6729:Trpm6 UTSW 19 18,807,661 (GRCm39) missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18,760,527 (GRCm39) missense probably benign
R7103:Trpm6 UTSW 19 18,790,911 (GRCm39) missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18,831,397 (GRCm39) nonsense probably null
R7128:Trpm6 UTSW 19 18,789,137 (GRCm39) missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R7263:Trpm6 UTSW 19 18,854,150 (GRCm39) missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18,755,949 (GRCm39) missense probably benign 0.13
R7305:Trpm6 UTSW 19 18,853,455 (GRCm39) missense probably benign 0.30
R7498:Trpm6 UTSW 19 18,853,484 (GRCm39) missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18,756,029 (GRCm39) missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18,809,945 (GRCm39) missense probably benign 0.31
R7646:Trpm6 UTSW 19 18,845,325 (GRCm39) missense probably benign 0.10
R7650:Trpm6 UTSW 19 18,853,377 (GRCm39) missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18,831,613 (GRCm39) missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18,804,772 (GRCm39) missense probably benign 0.03
R7747:Trpm6 UTSW 19 18,727,409 (GRCm39) splice site probably null
R7807:Trpm6 UTSW 19 18,807,220 (GRCm39) missense probably benign 0.11
R7870:Trpm6 UTSW 19 18,792,605 (GRCm39) missense probably benign 0.01
R7891:Trpm6 UTSW 19 18,754,074 (GRCm39) missense probably benign 0.01
R7955:Trpm6 UTSW 19 18,831,654 (GRCm39) missense probably benign 0.01
R7965:Trpm6 UTSW 19 18,853,474 (GRCm39) missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18,756,023 (GRCm39) missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18,792,714 (GRCm39) missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18,770,226 (GRCm39) missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18,789,154 (GRCm39) missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18,851,225 (GRCm39) missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18,831,332 (GRCm39) missense probably benign 0.39
R8413:Trpm6 UTSW 19 18,809,849 (GRCm39) missense probably benign 0.00
R8534:Trpm6 UTSW 19 18,869,459 (GRCm39) missense probably benign 0.00
R8932:Trpm6 UTSW 19 18,815,366 (GRCm39) missense possibly damaging 0.87
R8990:Trpm6 UTSW 19 18,792,799 (GRCm39) missense probably damaging 1.00
R9403:Trpm6 UTSW 19 18,810,016 (GRCm39) missense possibly damaging 0.84
R9446:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R9463:Trpm6 UTSW 19 18,761,264 (GRCm39) critical splice donor site probably null
R9485:Trpm6 UTSW 19 18,755,978 (GRCm39) missense probably benign 0.06
R9536:Trpm6 UTSW 19 18,764,123 (GRCm39) missense probably damaging 1.00
R9549:Trpm6 UTSW 19 18,853,394 (GRCm39) nonsense probably null
R9564:Trpm6 UTSW 19 18,851,240 (GRCm39) missense possibly damaging 0.92
R9626:Trpm6 UTSW 19 18,790,846 (GRCm39) missense probably damaging 1.00
R9655:Trpm6 UTSW 19 18,869,466 (GRCm39) missense probably benign
R9721:Trpm6 UTSW 19 18,807,336 (GRCm39) missense probably benign 0.12
R9742:Trpm6 UTSW 19 18,800,766 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGTGTCATTTGCTTCGATACTGTTGTGA -3'
(R):5'- GCCACAGAATGCTAACCTTCCTCAA -3'

Sequencing Primer
(F):5'- GCTTCGATACTGTTGTGAAAATGTC -3'
(R):5'- agattagcccaacacggaag -3'
Posted On 2014-05-23