Incidental Mutation 'R1779:Sorcs1'
ID 197409
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Name sortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 039810-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R1779 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 50131737-50667084 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 50163481 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000072685
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111756
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164039
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209413
Predicted Effect probably benign
Transcript: ENSMUST00000209783
Predicted Effect probably benign
Transcript: ENSMUST00000211008
Predicted Effect probably benign
Transcript: ENSMUST00000211687
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T G 3: 124,200,163 (GRCm39) L476F probably damaging Het
4930432E11Rik A T 7: 29,278,591 (GRCm39) noncoding transcript Het
A930011G23Rik A T 5: 99,370,897 (GRCm39) probably benign Het
Abcd3 A G 3: 121,575,612 (GRCm39) Y217H probably damaging Het
Abraxas1 A T 5: 100,965,822 (GRCm39) probably benign Het
Acsbg1 T C 9: 54,523,346 (GRCm39) Y427C probably damaging Het
Acsbg3 T A 17: 57,192,169 (GRCm39) Y577* probably null Het
Adam10 T A 9: 70,683,651 (GRCm39) probably benign Het
Adam24 G A 8: 41,134,004 (GRCm39) V491I possibly damaging Het
Adamts2 T G 11: 50,647,524 (GRCm39) V299G probably damaging Het
Adh7 A G 3: 137,929,752 (GRCm39) T143A probably damaging Het
Ahcyl1 A G 3: 107,581,419 (GRCm39) S81P probably benign Het
Arhgap20 C A 9: 51,761,215 (GRCm39) T986K probably benign Het
Atp13a5 A T 16: 29,133,478 (GRCm39) I391N possibly damaging Het
Atp6v0a1 C A 11: 100,917,511 (GRCm39) A143E probably benign Het
Calcrl A G 2: 84,181,629 (GRCm39) I173T probably damaging Het
Casz1 A G 4: 149,017,394 (GRCm39) T228A probably benign Het
Cckar A G 5: 53,857,321 (GRCm39) I292T probably damaging Het
Ccn5 G A 2: 163,670,906 (GRCm39) V138M probably damaging Het
Cfhr2 T A 1: 139,786,383 (GRCm39) probably null Het
Chkb T C 15: 89,313,260 (GRCm39) I109V possibly damaging Het
Clec2i T C 6: 128,865,069 (GRCm39) probably null Het
Clec4a4 T A 6: 123,000,934 (GRCm39) W216R probably damaging Het
Cntnap1 A C 11: 101,077,337 (GRCm39) I1000L probably damaging Het
Cp C A 3: 20,011,549 (GRCm39) D34E possibly damaging Het
Cse1l T C 2: 166,782,044 (GRCm39) probably null Het
Dennd3 T C 15: 73,394,357 (GRCm39) probably null Het
Dnah7a A G 1: 53,616,382 (GRCm39) V1193A probably benign Het
Eaf2 A G 16: 36,630,832 (GRCm39) probably null Het
Efcab3 T A 11: 104,611,765 (GRCm39) S536T probably benign Het
Ephb2 T C 4: 136,421,136 (GRCm39) T405A possibly damaging Het
Fam117a G A 11: 95,269,779 (GRCm39) V348M probably damaging Het
Fh1 T C 1: 175,428,990 (GRCm39) *167W probably null Het
Fmo9 T A 1: 166,490,868 (GRCm39) I486F probably benign Het
Gabbr1 T A 17: 37,365,771 (GRCm39) I150N probably damaging Het
Gfpt1 T C 6: 87,054,179 (GRCm39) V478A possibly damaging Het
Gm2663 A T 6: 40,974,894 (GRCm39) V59E probably damaging Het
Gm4868 T A 5: 125,925,176 (GRCm39) noncoding transcript Het
Heatr4 T A 12: 84,026,934 (GRCm39) T108S probably benign Het
Hells G T 19: 38,935,286 (GRCm39) A319S probably benign Het
Helz2 A G 2: 180,876,780 (GRCm39) V1238A probably benign Het
Helz2 T A 2: 180,880,252 (GRCm39) Q488L possibly damaging Het
Hkdc1 A G 10: 62,227,162 (GRCm39) F765S probably damaging Het
Hspg2 T A 4: 137,245,820 (GRCm39) W938R probably damaging Het
Itpr2 G A 6: 146,060,399 (GRCm39) R2473* probably null Het
Kctd1 C T 18: 15,194,839 (GRCm39) V595I probably benign Het
Krt7 A G 15: 101,321,290 (GRCm39) Y369C probably damaging Het
Krt72 T C 15: 101,689,364 (GRCm39) T323A probably benign Het
Krt76 A G 15: 101,801,122 (GRCm39) L58P unknown Het
Liph C A 16: 21,786,800 (GRCm39) R272L probably benign Het
Lrrc9 A T 12: 72,502,772 (GRCm39) K248* probably null Het
Mei4 T A 9: 81,809,195 (GRCm39) S93T probably damaging Het
Mgll T A 6: 88,790,930 (GRCm39) Y183* probably null Het
Myo5b A G 18: 74,875,218 (GRCm39) M1541V probably benign Het
Napg A G 18: 63,115,762 (GRCm39) E66G probably benign Het
Npr3 T C 15: 11,851,572 (GRCm39) D406G probably damaging Het
Nr2c2 A G 6: 92,136,224 (GRCm39) T355A possibly damaging Het
Or13j1 G A 4: 43,706,041 (GRCm39) H176Y probably damaging Het
Or4a71 A T 2: 89,357,989 (GRCm39) I255K probably benign Het
Or51m1 G T 7: 103,578,668 (GRCm39) V213L probably benign Het
Or51v8 A G 7: 103,319,845 (GRCm39) I131T probably benign Het
Or52z13 A T 7: 103,247,107 (GRCm39) I195F probably damaging Het
Or5b107 T C 19: 13,142,404 (GRCm39) Y9H probably benign Het
Or8d1 A G 9: 38,766,846 (GRCm39) M163V possibly damaging Het
Orai2 T C 5: 136,179,793 (GRCm39) E80G probably damaging Het
Pcdhb14 T A 18: 37,582,535 (GRCm39) V547E probably damaging Het
Pcdhb15 T C 18: 37,609,084 (GRCm39) I772T possibly damaging Het
Pcnt T C 10: 76,244,630 (GRCm39) Q1150R probably damaging Het
Pdcd6 A G 13: 74,453,700 (GRCm39) I146T probably damaging Het
Phldb2 T A 16: 45,621,988 (GRCm39) D664V probably damaging Het
Pik3ap1 A T 19: 41,320,673 (GRCm39) V182E probably damaging Het
Pip4k2a A G 2: 18,852,433 (GRCm39) V283A probably benign Het
Pkdrej A G 15: 85,705,372 (GRCm39) V188A possibly damaging Het
Pnpla6 T C 8: 3,591,404 (GRCm39) W1151R probably damaging Het
Ppp1r14c A G 10: 3,316,890 (GRCm39) Y75C probably damaging Het
Prl2b1 C T 13: 27,567,452 (GRCm39) D224N probably benign Het
Ptgis A G 2: 167,056,778 (GRCm39) S270P probably benign Het
Rgs11 C A 17: 26,429,640 (GRCm39) A446D probably damaging Het
Rims2 A G 15: 39,545,098 (GRCm39) T1531A probably damaging Het
Sbno1 A T 5: 124,526,580 (GRCm39) probably benign Het
Scarb2 C G 5: 92,596,416 (GRCm39) M409I probably benign Het
Scube3 C T 17: 28,387,353 (GRCm39) probably benign Het
Slc44a4 T C 17: 35,140,901 (GRCm39) I180T probably damaging Het
Slc9a2 T C 1: 40,781,803 (GRCm39) M344T probably damaging Het
Smc3 A T 19: 53,627,800 (GRCm39) T860S probably benign Het
Snrpa A G 7: 26,891,174 (GRCm39) I99T probably benign Het
Sorl1 C T 9: 41,902,778 (GRCm39) probably null Het
Suds3 T C 5: 117,243,309 (GRCm39) K143R probably benign Het
Supt20 A T 3: 54,622,164 (GRCm39) M424L probably benign Het
Tgtp2 T C 11: 48,949,751 (GRCm39) M274V probably benign Het
Tmem158 T A 9: 123,088,974 (GRCm39) M213L probably benign Het
Tnks C A 8: 35,324,672 (GRCm39) R639L probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trmt10c A C 16: 55,854,938 (GRCm39) N232K possibly damaging Het
Trpm6 C T 19: 18,833,581 (GRCm39) R1587W probably damaging Het
Trrap G A 5: 144,765,400 (GRCm39) V2539I probably benign Het
Tsg101 A G 7: 46,556,835 (GRCm39) S115P probably benign Het
Ttll13 G T 7: 79,910,256 (GRCm39) V800L probably benign Het
Vmn1r57 A G 7: 5,223,576 (GRCm39) T34A possibly damaging Het
Vmn2r118 T A 17: 55,918,530 (GRCm39) T121S probably benign Het
Wdr35 A G 12: 9,035,772 (GRCm39) I238M possibly damaging Het
Zfp81 T A 17: 33,554,080 (GRCm39) T245S probably benign Het
Zfyve26 G T 12: 79,325,237 (GRCm39) P824Q probably damaging Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50,178,492 (GRCm39) missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50,164,566 (GRCm39) missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50,216,639 (GRCm39) missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50,276,517 (GRCm39) splice site probably benign
IGL01445:Sorcs1 APN 19 50,141,504 (GRCm39) missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50,169,944 (GRCm39) missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50,218,647 (GRCm39) critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50,276,597 (GRCm39) splice site probably benign
IGL02111:Sorcs1 APN 19 50,218,683 (GRCm39) missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50,322,036 (GRCm39) missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50,171,109 (GRCm39) nonsense probably null
IGL02498:Sorcs1 APN 19 50,666,606 (GRCm39) missense probably benign
IGL02658:Sorcs1 APN 19 50,178,530 (GRCm39) missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50,666,368 (GRCm39) nonsense probably null
IGL02942:Sorcs1 APN 19 50,463,875 (GRCm39) missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50,248,194 (GRCm39) nonsense probably null
IGL03230:Sorcs1 APN 19 50,230,531 (GRCm39) missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50,141,345 (GRCm39) missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50,367,329 (GRCm39) splice site probably benign
R0115:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50,301,480 (GRCm39) splice site probably null
R0481:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0581:Sorcs1 UTSW 19 50,241,139 (GRCm39) missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50,230,380 (GRCm39) splice site probably benign
R0980:Sorcs1 UTSW 19 50,220,761 (GRCm39) missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50,132,598 (GRCm39) unclassified probably benign
R1519:Sorcs1 UTSW 19 50,241,025 (GRCm39) missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50,463,860 (GRCm39) missense probably damaging 0.99
R1783:Sorcs1 UTSW 19 50,216,747 (GRCm39) critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50,210,633 (GRCm39) missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50,666,630 (GRCm39) missense probably benign
R2206:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50,199,088 (GRCm39) missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50,139,659 (GRCm39) missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50,210,597 (GRCm39) missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50,178,599 (GRCm39) missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50,367,379 (GRCm39) missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50,301,402 (GRCm39) critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50,171,107 (GRCm39) missense probably benign
R4780:Sorcs1 UTSW 19 50,132,419 (GRCm39) unclassified probably benign
R4781:Sorcs1 UTSW 19 50,171,119 (GRCm39) missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50,218,740 (GRCm39) missense possibly damaging 0.87
R4823:Sorcs1 UTSW 19 50,666,578 (GRCm39) missense possibly damaging 0.92
R4883:Sorcs1 UTSW 19 50,220,741 (GRCm39) missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50,213,579 (GRCm39) missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50,241,040 (GRCm39) missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50,210,571 (GRCm39) missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50,171,213 (GRCm39) missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50,178,555 (GRCm39) nonsense probably null
R6091:Sorcs1 UTSW 19 50,276,539 (GRCm39) missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50,276,532 (GRCm39) missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50,169,852 (GRCm39) missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50,132,562 (GRCm39) missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50,213,615 (GRCm39) missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50,164,560 (GRCm39) nonsense probably null
R6792:Sorcs1 UTSW 19 50,666,606 (GRCm39) missense probably benign
R6891:Sorcs1 UTSW 19 50,213,557 (GRCm39) nonsense probably null
R7151:Sorcs1 UTSW 19 50,301,420 (GRCm39) missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50,178,480 (GRCm39) missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50,163,595 (GRCm39) missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50,250,701 (GRCm39) missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50,141,550 (GRCm39) missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50,141,490 (GRCm39) missense probably benign
R7506:Sorcs1 UTSW 19 50,171,112 (GRCm39) nonsense probably null
R7573:Sorcs1 UTSW 19 50,141,234 (GRCm39) nonsense probably null
R7867:Sorcs1 UTSW 19 50,218,698 (GRCm39) nonsense probably null
R7911:Sorcs1 UTSW 19 50,132,470 (GRCm39) missense unknown
R8032:Sorcs1 UTSW 19 50,463,846 (GRCm39) missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50,132,415 (GRCm39) missense unknown
R8463:Sorcs1 UTSW 19 50,248,248 (GRCm39) missense probably damaging 1.00
R8682:Sorcs1 UTSW 19 50,367,398 (GRCm39) missense probably damaging 0.99
R8724:Sorcs1 UTSW 19 50,139,658 (GRCm39) missense probably benign 0.33
R8926:Sorcs1 UTSW 19 50,241,096 (GRCm39) missense possibly damaging 0.94
R9160:Sorcs1 UTSW 19 50,213,658 (GRCm39) missense probably damaging 1.00
R9173:Sorcs1 UTSW 19 50,220,753 (GRCm39) missense possibly damaging 0.92
R9203:Sorcs1 UTSW 19 50,250,733 (GRCm39) missense probably damaging 1.00
R9229:Sorcs1 UTSW 19 50,141,300 (GRCm39) missense probably benign 0.17
R9398:Sorcs1 UTSW 19 50,213,651 (GRCm39) missense possibly damaging 0.90
R9430:Sorcs1 UTSW 19 50,199,208 (GRCm39) missense probably damaging 1.00
R9510:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9511:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9744:Sorcs1 UTSW 19 50,215,275 (GRCm39) missense probably damaging 1.00
R9777:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
X0024:Sorcs1 UTSW 19 50,171,201 (GRCm39) missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50,210,581 (GRCm39) missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50,322,037 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs1 UTSW 19 50,215,180 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCTGAAGAAGTCACCTTGTCTC -3'
(R):5'- AGTACCCACGTCTGTGCTCCTATG -3'

Sequencing Primer
(F):5'- AAGAAGTCACCTTGTCTCAGCTC -3'
(R):5'- ATCTGACATCTCCACTGGACG -3'
Posted On 2014-05-23