Mutagenetix > Incidental Mutations

Incidental Mutation 'R0083:Ttll4'

19741

Institutional Source

Beutler Lab

Gene Symbol

Ttll4

Ensembl Gene

ENSMUSG00000033257

Gene Name

tubulin tyrosine ligase-like family, member 4

Synonyms

4632407P03Rik

MMRRC Submission

038370-MU

Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R0083 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74661745-74703730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 74679769 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 260 (V260L)

Ref Sequence

ENSEMBL: ENSMUSP00000037406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]

Predicted Effect

probably benign
Transcript: ENSMUST00000042125
AA Change: V260L

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: V260L

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	645	940	2.2e-106	PFAM
low complexity region	942	961	N/A	INTRINSIC
low complexity region	1103	1113	N/A	INTRINSIC
low complexity region	1168	1182	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113678
AA Change: V260L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: V260L

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	636	876	3.4e-82	PFAM
low complexity region	878	897	N/A	INTRINSIC
low complexity region	1039	1049	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129890

SMART Domains

Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	69	101	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141119

SMART Domains

Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	56	96	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 97.8%
10x: 94.0%
20x: 83.1%

Validation Efficiency

88% (117/133)

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	A	T	2: 85,494,132	F283L	possibly damaging	Het
4930562C15Rik	A	T	16: 4,849,542	I266F	unknown	Het
Adam39	T	G	8: 40,825,078	F169V	probably damaging	Het
Adcy2	A	T	13: 68,651,935	V858E	probably damaging	Het
Adgrv1	A	G	13: 81,578,404		probably benign	Het
Ankrd26	G	T	6: 118,523,254	H1085Q	probably benign	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
Atg4c	C	T	4: 99,221,440	H215Y	possibly damaging	Het
Atp6v0d2	G	A	4: 19,880,001		probably benign	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
C1qtnf3	G	A	15: 10,975,632	V175I	possibly damaging	Het
Cacna1c	A	G	6: 118,625,523	M1293T	probably damaging	Het
Ccdc88a	T	A	11: 29,503,463	S337T	probably damaging	Het
Cntn4	A	G	6: 106,525,369	I362M	possibly damaging	Het
Col22a1	A	T	15: 71,890,497	D104E	possibly damaging	Het
Col4a4	T	C	1: 82,507,111		probably null	Het
Cul7	C	A	17: 46,655,556	R304S	probably benign	Het
Elfn2	A	T	15: 78,673,414	L311Q	probably damaging	Het
Esrrb	T	C	12: 86,514,452	L320P	probably damaging	Het
Fbxw10	A	G	11: 62,877,061	T903A	probably benign	Het
Fkbp4	G	A	6: 128,432,407		probably benign	Het
Gatad2b	T	A	3: 90,357,943	Y576N	probably damaging	Het
Greb1	T	C	12: 16,696,451	M1273V	probably benign	Het
Helq	C	A	5: 100,768,368	E913*	probably null	Het
Inpp4b	C	A	8: 81,741,462	A18E	possibly damaging	Het
Ints13	A	G	6: 146,550,664	Y686H	probably benign	Het
Itgb7	C	T	15: 102,223,482	R222H	probably damaging	Het
Krt81	A	G	15: 101,463,465	I78T	probably damaging	Het
Lonp2	G	A	8: 86,716,355	V815I	probably benign	Het
Mctp2	G	T	7: 72,228,516	F271L	possibly damaging	Het
Mrto4	C	T	4: 139,347,968	V175I	possibly damaging	Het
Myh14	A	G	7: 44,634,519	V654A	probably damaging	Het
Neu2	A	G	1: 87,597,262	Y323C	probably damaging	Het
Nt5dc1	A	C	10: 34,403,764	M94R	probably damaging	Het
Nup210l	A	G	3: 90,189,575	T1364A	probably damaging	Het
Obscn	T	C	11: 59,022,374	D6939G	probably damaging	Het
Olfr1491	A	T	19: 13,705,678	T284S	probably damaging	Het
Pias4	A	G	10: 81,164,166	S18P	probably damaging	Het
Plcl1	A	G	1: 55,697,939	Y813C	possibly damaging	Het
Plk5	G	A	10: 80,356,662	G34S	possibly damaging	Het
Ptprj	A	T	2: 90,469,777		probably null	Het
Rps6ka2	G	A	17: 7,296,043	D617N	probably benign	Het
Sap130	C	A	18: 31,666,329		probably benign	Het
Sap130	C	T	18: 31,711,641	P902S	probably damaging	Het
Sec11a	A	G	7: 80,935,039	V50A	probably damaging	Het
Sel1l3	C	T	5: 53,137,902	A786T	possibly damaging	Het
Shroom1	T	C	11: 53,466,937	S772P	possibly damaging	Het
Slc15a2	T	C	16: 36,782,283	Y72C	probably damaging	Het
Slc26a6	T	C	9: 108,859,113		probably null	Het
Slc30a5	G	T	13: 100,803,400	A669E	probably damaging	Het
Sppl2c	G	A	11: 104,186,532	V53I	probably benign	Het
Sstr1	T	A	12: 58,213,742	C384S	possibly damaging	Het
Sulf1	A	G	1: 12,817,417	M272V	probably damaging	Het
Tm6sf1	G	A	7: 81,865,345		probably null	Het
Tmem94	A	G	11: 115,796,724		probably benign	Het
Topaz1	A	T	9: 122,775,609	I1093L	probably benign	Het
Vmn2r26	A	T	6: 124,053,981		probably null	Het
Vmn2r75	G	A	7: 86,165,658	A209V	probably benign	Het
Zfand3	A	G	17: 30,135,398	E63G	probably damaging	Het
Zfp939	A	T	7: 39,474,110		noncoding transcript	Het

Other mutations in Ttll4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01606:Ttll4	APN	1	74685893	missense	probably damaging	1.00
IGL01743:Ttll4	APN	1	74688193	missense	possibly damaging	0.63
IGL01914:Ttll4	APN	1	74679058	missense	probably benign	0.01
IGL02288:Ttll4	APN	1	74679401	missense	probably benign	0.05
IGL02621:Ttll4	APN	1	74687484	missense	probably damaging	1.00
IGL02662:Ttll4	APN	1	74687231	unclassified	probably null
IGL02890:Ttll4	APN	1	74687339	nonsense	probably null
IGL02937:Ttll4	APN	1	74679503	missense	possibly damaging	0.92
IGL03178:Ttll4	APN	1	74680408	missense	probably damaging	0.96
IGL03412:Ttll4	APN	1	74687321	missense	probably benign	0.28
1mM(1):Ttll4	UTSW	1	74689980	missense	probably null	1.00
R0108:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0135:Ttll4	UTSW	1	74679928	missense	possibly damaging	0.86
R0137:Ttll4	UTSW	1	74679692	missense	possibly damaging	0.74
R0306:Ttll4	UTSW	1	74696757	missense	probably benign	0.28
R0506:Ttll4	UTSW	1	74688618	missense	probably benign	0.06
R0555:Ttll4	UTSW	1	74688280	missense	probably damaging	1.00
R1617:Ttll4	UTSW	1	74679401	missense	probably benign	0.05
R1649:Ttll4	UTSW	1	74697470	missense	possibly damaging	0.52
R1793:Ttll4	UTSW	1	74687840	missense	possibly damaging	0.91
R1898:Ttll4	UTSW	1	74697482	missense	probably benign	0.01
R1952:Ttll4	UTSW	1	74687559	missense	probably damaging	0.99
R1987:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R1989:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R2067:Ttll4	UTSW	1	74680382	missense	possibly damaging	0.94
R2162:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R2185:Ttll4	UTSW	1	74679829	missense	possibly damaging	0.54
R2875:Ttll4	UTSW	1	74686438	unclassified	probably null
R2876:Ttll4	UTSW	1	74686438	unclassified	probably null
R2895:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R2896:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R3157:Ttll4	UTSW	1	74697611	missense	possibly damaging	0.81
R3832:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R4707:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4784:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4785:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R5176:Ttll4	UTSW	1	74679286	missense	probably damaging	0.99
R5202:Ttll4	UTSW	1	74687852	critical splice donor site	probably null
R5244:Ttll4	UTSW	1	74696448	missense	probably benign	0.30
R5264:Ttll4	UTSW	1	74686376	missense	possibly damaging	0.92
R5452:Ttll4	UTSW	1	74679321	missense	probably benign	0.06
R5992:Ttll4	UTSW	1	74685391	missense	probably damaging	1.00
R6111:Ttll4	UTSW	1	74697539	missense	possibly damaging	0.95
R6722:Ttll4	UTSW	1	74681789	missense	possibly damaging	0.95
R6776:Ttll4	UTSW	1	74681353	missense	probably damaging	1.00
R6815:Ttll4	UTSW	1	74679349	missense	possibly damaging	0.89
R6836:Ttll4	UTSW	1	74689413	missense	probably damaging	0.98
R6963:Ttll4	UTSW	1	74681816	missense	probably damaging	1.00
R7271:Ttll4	UTSW	1	74688661	missense	possibly damaging	0.83
R7508:Ttll4	UTSW	1	74687259	missense	possibly damaging	0.81
R7714:Ttll4	UTSW	1	74679413	missense	probably benign	0.00
R7837:Ttll4	UTSW	1	74681757	critical splice acceptor site	probably null
R7920:Ttll4	UTSW	1	74681757	critical splice acceptor site	probably null
R8032:Ttll4	UTSW	1	74696473	missense	possibly damaging	0.82
R8036:Ttll4	UTSW	1	74679230	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CCACTGTCCTATAAGCCCATGCTG -3'
(R):5'- TCTGTTGAGAAGACCCCACTGGAAG -3'

Sequencing Primer
(F):5'- TCCTATAAGCCCATGCTGAACAAC -3'
(R):5'- AGCCTGTTCAAACTGGTAGC -3'

Posted On

2013-04-11