Mutagenetix > Incidental Mutation

Incidental Mutation 'R1780:Phf3'

197411

Institutional Source

Beutler Lab

Gene Symbol

Phf3

Ensembl Gene

ENSMUSG00000048874

Gene Name

PHD finger protein 3

Synonyms

AU020177, 2310061N19Rik

MMRRC Submission

039811-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1780 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30802339-30873921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 30811942 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1110 (D1110E)

Ref Sequence

ENSEMBL: ENSMUSP00000139610 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000191329]

AlphaFold

B2RQG2

Predicted Effect

probably damaging
Transcript: ENSMUST00000088310
AA Change: D1110E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: D1110E

Domain	Start	End	E-Value	Type
low complexity region	212	223	N/A	INTRINSIC
low complexity region	337	344	N/A	INTRINSIC
low complexity region	600	611	N/A	INTRINSIC
low complexity region	651	660	N/A	INTRINSIC
PHD	697	748	3.82e-10	SMART
low complexity region	847	859	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
TFS2M	908	1008	1.28e-47	SMART
Pfam:SPOC	1188	1294	4.2e-26	PFAM
low complexity region	1367	1373	N/A	INTRINSIC
low complexity region	1516	1529	N/A	INTRINSIC
low complexity region	1597	1620	N/A	INTRINSIC
low complexity region	1796	1811	N/A	INTRINSIC
low complexity region	1813	1846	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186105

Predicted Effect

probably damaging
Transcript: ENSMUST00000186733
AA Change: D1110E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: D1110E

Domain	Start	End	E-Value	Type
low complexity region	212	223	N/A	INTRINSIC
low complexity region	337	344	N/A	INTRINSIC
low complexity region	600	611	N/A	INTRINSIC
low complexity region	651	660	N/A	INTRINSIC
PHD	697	748	3.82e-10	SMART
low complexity region	847	859	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
TFS2M	908	1008	1.28e-47	SMART
Pfam:SPOC	1188	1294	4.2e-26	PFAM
low complexity region	1367	1373	N/A	INTRINSIC
low complexity region	1516	1529	N/A	INTRINSIC
low complexity region	1597	1620	N/A	INTRINSIC
low complexity region	1796	1811	N/A	INTRINSIC
low complexity region	1813	1846	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187316

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191245

Predicted Effect

probably benign
Transcript: ENSMUST00000191329

SMART Domains

Protein: ENSMUSP00000139662
Gene: ENSMUSG00000048874

Domain	Start	End	E-Value	Type
Pfam:SPOC	1	88	1.9e-17	PFAM

Meta Mutation Damage Score

0.1045

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.3%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,852,593	E493G	probably damaging	Het
Aff3	A	T	1: 38,535,702	S66T	probably damaging	Het
Ankrd17	T	A	5: 90,232,415	K2470N	probably damaging	Het
Ap3m1	T	C	14: 21,041,070	T156A	probably benign	Het
Arhgef4	T	A	1: 34,724,160	S832R	possibly damaging	Het
Asb10	T	C	5: 24,533,676	D423G	possibly damaging	Het
Ash1l	A	G	3: 88,965,984	T25A	probably benign	Het
Atp13a2	T	A	4: 141,002,460	L663I	possibly damaging	Het
Atp9b	A	T	18: 80,776,897	Y174*	probably null	Het
Bche	A	G	3: 73,700,620	I491T	probably benign	Het
Bckdhb	T	C	9: 83,953,783		probably null	Het
Cadps2	C	T	6: 23,320,932		probably null	Het
Cdc42bpb	A	T	12: 111,322,907	V468E	probably damaging	Het
Chrnd	T	C	1: 87,192,548	V33A	possibly damaging	Het
Col6a5	A	T	9: 105,936,878	V645D	unknown	Het
Cpa1	C	T	6: 30,643,008	L312F	probably damaging	Het
Cyp2a5	A	G	7: 26,841,876		probably benign	Het
Cyp2c39	C	A	19: 39,538,851		probably benign	Het
Cyp2d26	T	C	15: 82,794,007	N56S	probably damaging	Het
Ddx21	A	G	10: 62,594,147		probably benign	Het
Dnah11	A	T	12: 118,027,558	C2358S	probably damaging	Het
Entpd8	T	C	2: 25,084,306	S368P	probably benign	Het
Epg5	A	T	18: 78,023,990	Q2222L	probably damaging	Het
Ercc5	T	A	1: 44,167,796	V623E	probably benign	Het
Flg2	A	G	3: 93,202,999	E778G	unknown	Het
Gbe1	C	T	16: 70,495,324	R515*	probably null	Het
Hsd17b6	A	G	10: 127,994,327		probably null	Het
Hyal6	C	T	6: 24,734,032		probably benign	Het
Ifi27l2b	A	G	12: 103,451,319	I203T	probably damaging	Het
Kcnk9	A	C	15: 72,512,401	D309E	unknown	Het
Lrp6	C	T	6: 134,464,451	R1184Q	probably damaging	Het
Mdn1	T	C	4: 32,700,103	F1399L	probably damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Mx1	T	C	16: 97,451,512	*289W	probably null	Het
Myo7b	T	C	18: 31,961,185	E1970G	probably damaging	Het
Mypn	T	C	10: 63,121,964	Y24C	probably damaging	Het
Naxe	G	C	3: 88,057,133	P167A	probably benign	Het
Nmnat2	A	T	1: 153,112,440	K272*	probably null	Het
Nmnat3	C	T	9: 98,354,111	T19M	probably damaging	Het
Olfr1275	T	C	2: 111,231,698	I32V	probably benign	Het
Olfr1412	G	A	1: 92,588,389	V20M	probably benign	Het
Olfr1474	A	G	19: 13,471,362	T131A	probably benign	Het
Olfr64	A	T	7: 103,893,555	F60Y	probably damaging	Het
Olfr66	A	G	7: 103,881,592	V217A	probably benign	Het
Pgm3	T	G	9: 86,556,204	E509D	probably damaging	Het
Pkd1	T	G	17: 24,581,569	S3062A	probably benign	Het
Pogz	A	T	3: 94,870,126	K372N	possibly damaging	Het
Pou1f1	A	G	16: 65,523,470	Y15C	probably benign	Het
Ppfia2	A	G	10: 106,896,507	T972A	possibly damaging	Het
Rasip1	A	G	7: 45,635,318	Y703C	possibly damaging	Het
Recql	T	A	6: 142,364,598	Q502L	probably benign	Het
Rgs9	A	T	11: 109,239,499	Y383*	probably null	Het
Rimbp3	T	C	16: 17,212,632	S1307P	probably benign	Het
Rspo1	A	G	4: 125,007,745	T200A	probably damaging	Het
Ryr3	C	T	2: 112,867,292	M922I	probably damaging	Het
Samm50	C	T	15: 84,211,127	A438V	probably damaging	Het
Sec1	A	C	7: 45,678,832	S264A	probably benign	Het
Sec31a	A	T	5: 100,381,336		probably null	Het
Slc13a3	T	C	2: 165,406,699	N553S	unknown	Het
Smg6	T	A	11: 74,946,116	L852Q	probably damaging	Het
Spata13	A	G	14: 60,691,725	N244S	probably damaging	Het
Srbd1	T	C	17: 86,057,685	R648G	probably damaging	Het
Sugct	T	G	13: 17,452,454		probably null	Het
Tmed10	A	G	12: 85,354,879	Y85H	probably damaging	Het
Trim68	A	G	7: 102,684,073	I134T	possibly damaging	Het
Trio	A	G	15: 27,744,038	C2603R	possibly damaging	Het
Tspyl3	G	A	2: 153,225,256	R21W	probably damaging	Het
Ttn	T	C	2: 76,810,699	I11863V	probably null	Het
Ubp1	G	A	9: 113,964,579	A283T	possibly damaging	Het
Ubtf	A	T	11: 102,314,918	F60L	probably damaging	Het
Vmn1r235	T	C	17: 21,261,737	I108T	probably benign	Het
Vmn2r125	T	C	4: 156,351,373	S349P	probably damaging	Het
Vmn2r25	A	G	6: 123,828,465	S478P	probably damaging	Het
Vmn2r88	T	A	14: 51,418,572	V746D	probably damaging	Het
Zcwpw1	A	G	5: 137,796,652	K37E	probably damaging	Het
Zdhhc24	T	C	19: 4,883,766	S284P	probably damaging	Het
Zswim8	C	A	14: 20,716,327	H841N	probably damaging	Het

Other mutations in Phf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Phf3	APN	1	30811847	missense	probably damaging	0.99
IGL00704:Phf3	APN	1	30804838	missense	probably benign
IGL01147:Phf3	APN	1	30804169	missense	probably damaging	1.00
IGL01360:Phf3	APN	1	30808728	missense	probably damaging	1.00
IGL01376:Phf3	APN	1	30830485	missense	possibly damaging	0.62
IGL01396:Phf3	APN	1	30804305	nonsense	probably null
IGL01830:Phf3	APN	1	30814067	nonsense	probably null
IGL02108:Phf3	APN	1	30829951	missense	probably damaging	1.00
IGL02156:Phf3	APN	1	30808778	missense	probably damaging	1.00
IGL02576:Phf3	APN	1	30830036	missense	probably benign	0.01
IGL03031:Phf3	APN	1	30804653	missense	probably benign	0.00
IGL03334:Phf3	APN	1	30805729	missense	probably damaging	0.99
IGL03411:Phf3	APN	1	30804401	missense	probably damaging	1.00
FR4976:Phf3	UTSW	1	30805023	utr 3 prime	probably benign
PIT4458001:Phf3	UTSW	1	30816541	missense	probably damaging	1.00
R0037:Phf3	UTSW	1	30804918	missense	probably benign	0.03
R0052:Phf3	UTSW	1	30808767	missense	probably damaging	1.00
R0114:Phf3	UTSW	1	30805443	missense	possibly damaging	0.87
R0123:Phf3	UTSW	1	30805065	missense	probably benign	0.01
R0225:Phf3	UTSW	1	30805065	missense	probably benign	0.01
R0715:Phf3	UTSW	1	30811838	missense	probably damaging	1.00
R0835:Phf3	UTSW	1	30830551	missense	probably benign	0.02
R0848:Phf3	UTSW	1	30863172	missense	probably damaging	1.00
R1473:Phf3	UTSW	1	30805940	missense	probably damaging	1.00
R1522:Phf3	UTSW	1	30805648	missense	probably benign	0.05
R1549:Phf3	UTSW	1	30804842	missense	probably benign	0.00
R1555:Phf3	UTSW	1	30805877	missense	possibly damaging	0.86
R1789:Phf3	UTSW	1	30806206	missense	probably damaging	1.00
R1875:Phf3	UTSW	1	30830623	missense	possibly damaging	0.81
R1912:Phf3	UTSW	1	30804345	missense	probably damaging	1.00
R1957:Phf3	UTSW	1	30831520	missense	probably damaging	1.00
R2019:Phf3	UTSW	1	30811847	missense	probably damaging	0.99
R2259:Phf3	UTSW	1	30804343	missense	probably benign	0.20
R2305:Phf3	UTSW	1	30805475	nonsense	probably null
R2345:Phf3	UTSW	1	30805351	nonsense	probably null
R2424:Phf3	UTSW	1	30806349	missense	probably damaging	1.00
R2497:Phf3	UTSW	1	30830014	missense	probably damaging	1.00
R2504:Phf3	UTSW	1	30810789	missense	probably damaging	1.00
R3522:Phf3	UTSW	1	30805603	missense	probably damaging	1.00
R3816:Phf3	UTSW	1	30805753	missense	probably damaging	1.00
R4152:Phf3	UTSW	1	30831458	missense	probably benign	0.13
R4403:Phf3	UTSW	1	30804409	missense	probably damaging	1.00
R4658:Phf3	UTSW	1	30863088	missense	probably damaging	1.00
R4663:Phf3	UTSW	1	30821215	missense	probably damaging	1.00
R4669:Phf3	UTSW	1	30829946	missense	probably damaging	1.00
R4706:Phf3	UTSW	1	30805606	missense	probably damaging	1.00
R4757:Phf3	UTSW	1	30820827	missense	probably damaging	1.00
R4766:Phf3	UTSW	1	30813939	unclassified	probably benign
R4786:Phf3	UTSW	1	30816557	nonsense	probably null
R5107:Phf3	UTSW	1	30831485	missense	probably benign	0.03
R5155:Phf3	UTSW	1	30824376	missense	possibly damaging	0.87
R5310:Phf3	UTSW	1	30803806	missense	probably damaging	1.00
R5823:Phf3	UTSW	1	30804683	missense	probably damaging	1.00
R5944:Phf3	UTSW	1	30820704	missense	probably damaging	1.00
R5979:Phf3	UTSW	1	30805746	missense	probably damaging	1.00
R6007:Phf3	UTSW	1	30804345	missense	probably damaging	1.00
R6024:Phf3	UTSW	1	30863226	missense	probably damaging	1.00
R6072:Phf3	UTSW	1	30830688	missense	probably benign	0.08
R6533:Phf3	UTSW	1	30806318	missense	probably damaging	1.00
R6649:Phf3	UTSW	1	30805023	missense	possibly damaging	0.75
R6653:Phf3	UTSW	1	30805023	missense	possibly damaging	0.75
R6852:Phf3	UTSW	1	30804630	missense	probably damaging	0.97
R6855:Phf3	UTSW	1	30820123	missense	probably damaging	1.00
R6862:Phf3	UTSW	1	30813982	missense	probably damaging	1.00
R6930:Phf3	UTSW	1	30811877	missense	probably damaging	1.00
R7135:Phf3	UTSW	1	30831109	missense	possibly damaging	0.61
R7323:Phf3	UTSW	1	30813130	missense	probably benign	0.01
R7352:Phf3	UTSW	1	30804326	missense	possibly damaging	0.87
R7455:Phf3	UTSW	1	30837158	missense	probably damaging	0.96
R7549:Phf3	UTSW	1	30831475	missense	probably benign	0.01
R7609:Phf3	UTSW	1	30805501	missense	probably benign	0.05
R7720:Phf3	UTSW	1	30829857	missense	probably damaging	1.00
R7745:Phf3	UTSW	1	30804224	missense	probably damaging	1.00
R8134:Phf3	UTSW	1	30824471	missense	unknown
R8264:Phf3	UTSW	1	30831057	missense	possibly damaging	0.48
R8545:Phf3	UTSW	1	30824310	missense	possibly damaging	0.48
R8821:Phf3	UTSW	1	30821266	nonsense	probably null
R8831:Phf3	UTSW	1	30821266	nonsense	probably null
R8873:Phf3	UTSW	1	30804692	missense	possibly damaging	0.74
R9101:Phf3	UTSW	1	30803945	missense	possibly damaging	0.56
R9402:Phf3	UTSW	1	30811847	missense	probably damaging	0.99
R9426:Phf3	UTSW	1	30831544	nonsense	probably null
R9594:Phf3	UTSW	1	30829922	missense	probably benign	0.07
R9707:Phf3	UTSW	1	30829842	critical splice donor site	probably null
R9803:Phf3	UTSW	1	30830791	missense	probably benign	0.16
Z1177:Phf3	UTSW	1	30804295	missense	probably damaging	1.00
Z1177:Phf3	UTSW	1	30805051	missense	unknown
Z1177:Phf3	UTSW	1	30811968	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCAAAGCTTATTCTAGACTATGCCCG -3'
(R):5'- TCACAGTGTGAGGAAACCACATTTCAG -3'

Sequencing Primer
(F):5'- TTATTCTAGACTATGCCCGAGAGAGG -3'
(R):5'- CTGGGTGCCATTGATAAATTATTTGC -3'

Posted On

2014-05-23