Mutagenetix > Incidental Mutation

Incidental Mutation 'R1780:Arhgef4'

197412

Institutional Source

Beutler Lab

Gene Symbol

Arhgef4

Ensembl Gene

ENSMUSG00000037509

Gene Name

Rho guanine nucleotide exchange factor (GEF) 4

Synonyms

9330140K16Rik, Asef

MMRRC Submission

039811-MU

Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1780 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34678188-34813309 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34724160 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 832 (S832R)

Ref Sequence

ENSEMBL: ENSMUSP00000124213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159747]

AlphaFold

Q7TNR9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159747
AA Change: S832R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509
AA Change: S832R

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	686	712	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	1119	1137	N/A	INTRINSIC
low complexity region	1240	1254	N/A	INTRINSIC
SH3	1361	1416	3.73e-16	SMART
RhoGEF	1453	1632	3.86e-56	SMART
PH	1665	1773	2.33e-14	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.3%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,852,593	E493G	probably damaging	Het
Aff3	A	T	1: 38,535,702	S66T	probably damaging	Het
Ankrd17	T	A	5: 90,232,415	K2470N	probably damaging	Het
Ap3m1	T	C	14: 21,041,070	T156A	probably benign	Het
Asb10	T	C	5: 24,533,676	D423G	possibly damaging	Het
Ash1l	A	G	3: 88,965,984	T25A	probably benign	Het
Atp13a2	T	A	4: 141,002,460	L663I	possibly damaging	Het
Atp9b	A	T	18: 80,776,897	Y174*	probably null	Het
Bche	A	G	3: 73,700,620	I491T	probably benign	Het
Bckdhb	T	C	9: 83,953,783		probably null	Het
Cadps2	C	T	6: 23,320,932		probably null	Het
Cdc42bpb	A	T	12: 111,322,907	V468E	probably damaging	Het
Chrnd	T	C	1: 87,192,548	V33A	possibly damaging	Het
Col6a5	A	T	9: 105,936,878	V645D	unknown	Het
Cpa1	C	T	6: 30,643,008	L312F	probably damaging	Het
Cyp2a5	A	G	7: 26,841,876		probably benign	Het
Cyp2c39	C	A	19: 39,538,851		probably benign	Het
Cyp2d26	T	C	15: 82,794,007	N56S	probably damaging	Het
Ddx21	A	G	10: 62,594,147		probably benign	Het
Dnah11	A	T	12: 118,027,558	C2358S	probably damaging	Het
Entpd8	T	C	2: 25,084,306	S368P	probably benign	Het
Epg5	A	T	18: 78,023,990	Q2222L	probably damaging	Het
Ercc5	T	A	1: 44,167,796	V623E	probably benign	Het
Flg2	A	G	3: 93,202,999	E778G	unknown	Het
Gbe1	C	T	16: 70,495,324	R515*	probably null	Het
Hsd17b6	A	G	10: 127,994,327		probably null	Het
Hyal6	C	T	6: 24,734,032		probably benign	Het
Ifi27l2b	A	G	12: 103,451,319	I203T	probably damaging	Het
Kcnk9	A	C	15: 72,512,401	D309E	unknown	Het
Lrp6	C	T	6: 134,464,451	R1184Q	probably damaging	Het
Mdn1	T	C	4: 32,700,103	F1399L	probably damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Mx1	T	C	16: 97,451,512	*289W	probably null	Het
Myo7b	T	C	18: 31,961,185	E1970G	probably damaging	Het
Mypn	T	C	10: 63,121,964	Y24C	probably damaging	Het
Naxe	G	C	3: 88,057,133	P167A	probably benign	Het
Nmnat2	A	T	1: 153,112,440	K272*	probably null	Het
Nmnat3	C	T	9: 98,354,111	T19M	probably damaging	Het
Olfr1275	T	C	2: 111,231,698	I32V	probably benign	Het
Olfr1412	G	A	1: 92,588,389	V20M	probably benign	Het
Olfr1474	A	G	19: 13,471,362	T131A	probably benign	Het
Olfr64	A	T	7: 103,893,555	F60Y	probably damaging	Het
Olfr66	A	G	7: 103,881,592	V217A	probably benign	Het
Pgm3	T	G	9: 86,556,204	E509D	probably damaging	Het
Phf3	A	T	1: 30,811,942	D1110E	probably damaging	Het
Pkd1	T	G	17: 24,581,569	S3062A	probably benign	Het
Pogz	A	T	3: 94,870,126	K372N	possibly damaging	Het
Pou1f1	A	G	16: 65,523,470	Y15C	probably benign	Het
Ppfia2	A	G	10: 106,896,507	T972A	possibly damaging	Het
Rasip1	A	G	7: 45,635,318	Y703C	possibly damaging	Het
Recql	T	A	6: 142,364,598	Q502L	probably benign	Het
Rgs9	A	T	11: 109,239,499	Y383*	probably null	Het
Rimbp3	T	C	16: 17,212,632	S1307P	probably benign	Het
Rspo1	A	G	4: 125,007,745	T200A	probably damaging	Het
Ryr3	C	T	2: 112,867,292	M922I	probably damaging	Het
Samm50	C	T	15: 84,211,127	A438V	probably damaging	Het
Sec1	A	C	7: 45,678,832	S264A	probably benign	Het
Sec31a	A	T	5: 100,381,336		probably null	Het
Slc13a3	T	C	2: 165,406,699	N553S	unknown	Het
Smg6	T	A	11: 74,946,116	L852Q	probably damaging	Het
Spata13	A	G	14: 60,691,725	N244S	probably damaging	Het
Srbd1	T	C	17: 86,057,685	R648G	probably damaging	Het
Sugct	T	G	13: 17,452,454		probably null	Het
Tmed10	A	G	12: 85,354,879	Y85H	probably damaging	Het
Trim68	A	G	7: 102,684,073	I134T	possibly damaging	Het
Trio	A	G	15: 27,744,038	C2603R	possibly damaging	Het
Tspyl3	G	A	2: 153,225,256	R21W	probably damaging	Het
Ttn	T	C	2: 76,810,699	I11863V	probably null	Het
Ubp1	G	A	9: 113,964,579	A283T	possibly damaging	Het
Ubtf	A	T	11: 102,314,918	F60L	probably damaging	Het
Vmn1r235	T	C	17: 21,261,737	I108T	probably benign	Het
Vmn2r125	T	C	4: 156,351,373	S349P	probably damaging	Het
Vmn2r25	A	G	6: 123,828,465	S478P	probably damaging	Het
Vmn2r88	T	A	14: 51,418,572	V746D	probably damaging	Het
Zcwpw1	A	G	5: 137,796,652	K37E	probably damaging	Het
Zdhhc24	T	C	19: 4,883,766	S284P	probably damaging	Het
Zswim8	C	A	14: 20,716,327	H841N	probably damaging	Het

Other mutations in Arhgef4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00896:Arhgef4	APN	1	34811696	missense	possibly damaging	0.88
IGL02376:Arhgef4	APN	1	34806059	missense	probably damaging	1.00
IGL02604:Arhgef4	APN	1	34811723	nonsense	probably null
IGL03240:Arhgef4	APN	1	34806026	missense	probably benign	0.03
BB004:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
BB014:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R0095:Arhgef4	UTSW	1	34732370	nonsense	probably null
R0157:Arhgef4	UTSW	1	34806394	missense	probably damaging	1.00
R0243:Arhgef4	UTSW	1	34806999	splice site	probably null
R0383:Arhgef4	UTSW	1	34810533	missense	probably damaging	1.00
R0440:Arhgef4	UTSW	1	34745448	splice site	probably null
R0452:Arhgef4	UTSW	1	34732322	missense	probably damaging	0.97
R0893:Arhgef4	UTSW	1	34807110	missense	probably damaging	1.00
R1429:Arhgef4	UTSW	1	34810339	missense	probably damaging	1.00
R1437:Arhgef4	UTSW	1	34723945	missense	unknown
R1669:Arhgef4	UTSW	1	34732158	missense	possibly damaging	0.86
R1809:Arhgef4	UTSW	1	34810555	critical splice donor site	probably null
R1879:Arhgef4	UTSW	1	34722440	missense	unknown
R1908:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01
R1919:Arhgef4	UTSW	1	34811140	missense	probably damaging	0.98
R2020:Arhgef4	UTSW	1	34723810	missense	unknown
R2058:Arhgef4	UTSW	1	34722377	missense	unknown
R2213:Arhgef4	UTSW	1	34807149	splice site	probably null
R2851:Arhgef4	UTSW	1	34724048	missense	unknown
R2852:Arhgef4	UTSW	1	34724048	missense	unknown
R2853:Arhgef4	UTSW	1	34724048	missense	unknown
R3697:Arhgef4	UTSW	1	34722440	missense	unknown
R4012:Arhgef4	UTSW	1	34725106	missense	possibly damaging	0.75
R4118:Arhgef4	UTSW	1	34732347	missense	probably damaging	0.98
R4133:Arhgef4	UTSW	1	34806104	missense	probably damaging	1.00
R4534:Arhgef4	UTSW	1	34723081	missense	unknown
R4535:Arhgef4	UTSW	1	34723081	missense	unknown
R4581:Arhgef4	UTSW	1	34732124	missense	possibly damaging	0.83
R4665:Arhgef4	UTSW	1	34806032	missense	possibly damaging	0.89
R4678:Arhgef4	UTSW	1	34722668	missense	unknown
R4684:Arhgef4	UTSW	1	34811785	splice site	probably null
R4706:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
R4745:Arhgef4	UTSW	1	34807275	missense	probably damaging	1.00
R4747:Arhgef4	UTSW	1	34723274	missense	unknown
R4988:Arhgef4	UTSW	1	34723454	missense	unknown
R5063:Arhgef4	UTSW	1	34724215	missense	probably benign	0.00
R5154:Arhgef4	UTSW	1	34732374	missense	probably benign	0.43
R5156:Arhgef4	UTSW	1	34723274	missense	unknown
R5263:Arhgef4	UTSW	1	34724997	missense	possibly damaging	0.84
R5450:Arhgef4	UTSW	1	34807324	intron	probably benign
R5807:Arhgef4	UTSW	1	34807615	intron	probably benign
R5863:Arhgef4	UTSW	1	34722845	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6311:Arhgef4	UTSW	1	34723981	missense	unknown
R6315:Arhgef4	UTSW	1	34723477	missense	unknown
R6316:Arhgef4	UTSW	1	34723477	missense	unknown
R6318:Arhgef4	UTSW	1	34723477	missense	unknown
R6323:Arhgef4	UTSW	1	34723477	missense	unknown
R6324:Arhgef4	UTSW	1	34723477	missense	unknown
R6325:Arhgef4	UTSW	1	34723477	missense	unknown
R6340:Arhgef4	UTSW	1	34732223	missense	probably damaging	1.00
R6835:Arhgef4	UTSW	1	34806493	missense	probably damaging	1.00
R6981:Arhgef4	UTSW	1	34722452	missense	unknown
R7087:Arhgef4	UTSW	1	34811686	missense	probably damaging	0.96
R7297:Arhgef4	UTSW	1	34807192	missense	probably damaging	1.00
R7525:Arhgef4	UTSW	1	34809704	missense	probably damaging	1.00
R7614:Arhgef4	UTSW	1	34732235	missense	possibly damaging	0.67
R7693:Arhgef4	UTSW	1	34724141	missense	probably benign	0.01
R7892:Arhgef4	UTSW	1	34721804	missense	unknown
R7895:Arhgef4	UTSW	1	34806397	missense	probably damaging	1.00
R7927:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R7965:Arhgef4	UTSW	1	34811681	missense	probably benign
R7973:Arhgef4	UTSW	1	34724437	missense	possibly damaging	0.83
R7979:Arhgef4	UTSW	1	34721897	missense	unknown
R8160:Arhgef4	UTSW	1	34723574	missense	unknown
R8175:Arhgef4	UTSW	1	34810374	missense	probably benign
R8178:Arhgef4	UTSW	1	34722902	missense	unknown
R9046:Arhgef4	UTSW	1	34811765	missense	possibly damaging	0.92
R9077:Arhgef4	UTSW	1	34721743	missense	unknown
R9209:Arhgef4	UTSW	1	34725160	critical splice donor site	probably null
R9209:Arhgef4	UTSW	1	34810495	missense	probably benign
R9355:Arhgef4	UTSW	1	34810549	missense	probably benign	0.02
R9489:Arhgef4	UTSW	1	34722664	missense	unknown
R9509:Arhgef4	UTSW	1	34723691	missense	unknown
R9605:Arhgef4	UTSW	1	34722664	missense	unknown
R9665:Arhgef4	UTSW	1	34810437	missense	probably benign
R9675:Arhgef4	UTSW	1	34806027	missense	probably benign
R9790:Arhgef4	UTSW	1	34793364	critical splice donor site	probably null
R9791:Arhgef4	UTSW	1	34793364	critical splice donor site	probably null
RF012:Arhgef4	UTSW	1	34724484	small deletion	probably benign
X0062:Arhgef4	UTSW	1	34724227	missense	probably benign	0.35
YA93:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
Z1176:Arhgef4	UTSW	1	34723729	missense	unknown
Z1176:Arhgef4	UTSW	1	34804926	missense	probably damaging	1.00
Z1177:Arhgef4	UTSW	1	34722921	missense	unknown
Z1177:Arhgef4	UTSW	1	34723366	missense	unknown
Z1177:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTCTTGGCTTCAAGCACCACAAC -3'
(R):5'- GCATCTTTGCTTCTCAGAAACGCAC -3'

Sequencing Primer
(F):5'- AGTTCCAGGAACCATGCG -3'
(R):5'- CCTTTGACAGAGCCAGTATTTG -3'

Posted On

2014-05-23