Incidental Mutation 'R1780:Arhgef4'
ID 197412
Institutional Source Beutler Lab
Gene Symbol Arhgef4
Ensembl Gene ENSMUSG00000037509
Gene Name Rho guanine nucleotide exchange factor (GEF) 4
Synonyms 9330140K16Rik, Asef
MMRRC Submission 039811-MU
Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Essential gene? Non essential (E-score: 0.000) question?
Stock # R1780 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 34678188-34813309 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34724160 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 832 (S832R)
Ref Sequence ENSEMBL: ENSMUSP00000124213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159747]
AlphaFold Q7TNR9
Predicted Effect possibly damaging
Transcript: ENSMUST00000159747
AA Change: S832R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509
AA Change: S832R

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 686 712 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1119 1137 N/A INTRINSIC
low complexity region 1240 1254 N/A INTRINSIC
SH3 1361 1416 3.73e-16 SMART
RhoGEF 1453 1632 3.86e-56 SMART
PH 1665 1773 2.33e-14 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,852,593 E493G probably damaging Het
Aff3 A T 1: 38,535,702 S66T probably damaging Het
Ankrd17 T A 5: 90,232,415 K2470N probably damaging Het
Ap3m1 T C 14: 21,041,070 T156A probably benign Het
Asb10 T C 5: 24,533,676 D423G possibly damaging Het
Ash1l A G 3: 88,965,984 T25A probably benign Het
Atp13a2 T A 4: 141,002,460 L663I possibly damaging Het
Atp9b A T 18: 80,776,897 Y174* probably null Het
Bche A G 3: 73,700,620 I491T probably benign Het
Bckdhb T C 9: 83,953,783 probably null Het
Cadps2 C T 6: 23,320,932 probably null Het
Cdc42bpb A T 12: 111,322,907 V468E probably damaging Het
Chrnd T C 1: 87,192,548 V33A possibly damaging Het
Col6a5 A T 9: 105,936,878 V645D unknown Het
Cpa1 C T 6: 30,643,008 L312F probably damaging Het
Cyp2a5 A G 7: 26,841,876 probably benign Het
Cyp2c39 C A 19: 39,538,851 probably benign Het
Cyp2d26 T C 15: 82,794,007 N56S probably damaging Het
Ddx21 A G 10: 62,594,147 probably benign Het
Dnah11 A T 12: 118,027,558 C2358S probably damaging Het
Entpd8 T C 2: 25,084,306 S368P probably benign Het
Epg5 A T 18: 78,023,990 Q2222L probably damaging Het
Ercc5 T A 1: 44,167,796 V623E probably benign Het
Flg2 A G 3: 93,202,999 E778G unknown Het
Gbe1 C T 16: 70,495,324 R515* probably null Het
Hsd17b6 A G 10: 127,994,327 probably null Het
Hyal6 C T 6: 24,734,032 probably benign Het
Ifi27l2b A G 12: 103,451,319 I203T probably damaging Het
Kcnk9 A C 15: 72,512,401 D309E unknown Het
Lrp6 C T 6: 134,464,451 R1184Q probably damaging Het
Mdn1 T C 4: 32,700,103 F1399L probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mx1 T C 16: 97,451,512 *289W probably null Het
Myo7b T C 18: 31,961,185 E1970G probably damaging Het
Mypn T C 10: 63,121,964 Y24C probably damaging Het
Naxe G C 3: 88,057,133 P167A probably benign Het
Nmnat2 A T 1: 153,112,440 K272* probably null Het
Nmnat3 C T 9: 98,354,111 T19M probably damaging Het
Olfr1275 T C 2: 111,231,698 I32V probably benign Het
Olfr1412 G A 1: 92,588,389 V20M probably benign Het
Olfr1474 A G 19: 13,471,362 T131A probably benign Het
Olfr64 A T 7: 103,893,555 F60Y probably damaging Het
Olfr66 A G 7: 103,881,592 V217A probably benign Het
Pgm3 T G 9: 86,556,204 E509D probably damaging Het
Phf3 A T 1: 30,811,942 D1110E probably damaging Het
Pkd1 T G 17: 24,581,569 S3062A probably benign Het
Pogz A T 3: 94,870,126 K372N possibly damaging Het
Pou1f1 A G 16: 65,523,470 Y15C probably benign Het
Ppfia2 A G 10: 106,896,507 T972A possibly damaging Het
Rasip1 A G 7: 45,635,318 Y703C possibly damaging Het
Recql T A 6: 142,364,598 Q502L probably benign Het
Rgs9 A T 11: 109,239,499 Y383* probably null Het
Rimbp3 T C 16: 17,212,632 S1307P probably benign Het
Rspo1 A G 4: 125,007,745 T200A probably damaging Het
Ryr3 C T 2: 112,867,292 M922I probably damaging Het
Samm50 C T 15: 84,211,127 A438V probably damaging Het
Sec1 A C 7: 45,678,832 S264A probably benign Het
Sec31a A T 5: 100,381,336 probably null Het
Slc13a3 T C 2: 165,406,699 N553S unknown Het
Smg6 T A 11: 74,946,116 L852Q probably damaging Het
Spata13 A G 14: 60,691,725 N244S probably damaging Het
Srbd1 T C 17: 86,057,685 R648G probably damaging Het
Sugct T G 13: 17,452,454 probably null Het
Tmed10 A G 12: 85,354,879 Y85H probably damaging Het
Trim68 A G 7: 102,684,073 I134T possibly damaging Het
Trio A G 15: 27,744,038 C2603R possibly damaging Het
Tspyl3 G A 2: 153,225,256 R21W probably damaging Het
Ttn T C 2: 76,810,699 I11863V probably null Het
Ubp1 G A 9: 113,964,579 A283T possibly damaging Het
Ubtf A T 11: 102,314,918 F60L probably damaging Het
Vmn1r235 T C 17: 21,261,737 I108T probably benign Het
Vmn2r125 T C 4: 156,351,373 S349P probably damaging Het
Vmn2r25 A G 6: 123,828,465 S478P probably damaging Het
Vmn2r88 T A 14: 51,418,572 V746D probably damaging Het
Zcwpw1 A G 5: 137,796,652 K37E probably damaging Het
Zdhhc24 T C 19: 4,883,766 S284P probably damaging Het
Zswim8 C A 14: 20,716,327 H841N probably damaging Het
Other mutations in Arhgef4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Arhgef4 APN 1 34811696 missense possibly damaging 0.88
IGL02376:Arhgef4 APN 1 34806059 missense probably damaging 1.00
IGL02604:Arhgef4 APN 1 34811723 nonsense probably null
IGL03240:Arhgef4 APN 1 34806026 missense probably benign 0.03
BB004:Arhgef4 UTSW 1 34807253 missense probably damaging 1.00
BB014:Arhgef4 UTSW 1 34807253 missense probably damaging 1.00
R0095:Arhgef4 UTSW 1 34732370 nonsense probably null
R0157:Arhgef4 UTSW 1 34806394 missense probably damaging 1.00
R0243:Arhgef4 UTSW 1 34806999 splice site probably null
R0383:Arhgef4 UTSW 1 34810533 missense probably damaging 1.00
R0440:Arhgef4 UTSW 1 34745448 splice site probably null
R0452:Arhgef4 UTSW 1 34732322 missense probably damaging 0.97
R0893:Arhgef4 UTSW 1 34807110 missense probably damaging 1.00
R1429:Arhgef4 UTSW 1 34810339 missense probably damaging 1.00
R1437:Arhgef4 UTSW 1 34723945 missense unknown
R1669:Arhgef4 UTSW 1 34732158 missense possibly damaging 0.86
R1809:Arhgef4 UTSW 1 34810555 critical splice donor site probably null
R1879:Arhgef4 UTSW 1 34722440 missense unknown
R1908:Arhgef4 UTSW 1 34724259 missense probably benign 0.01
R1919:Arhgef4 UTSW 1 34811140 missense probably damaging 0.98
R2020:Arhgef4 UTSW 1 34723810 missense unknown
R2058:Arhgef4 UTSW 1 34722377 missense unknown
R2213:Arhgef4 UTSW 1 34807149 splice site probably null
R2851:Arhgef4 UTSW 1 34724048 missense unknown
R2852:Arhgef4 UTSW 1 34724048 missense unknown
R2853:Arhgef4 UTSW 1 34724048 missense unknown
R3697:Arhgef4 UTSW 1 34722440 missense unknown
R4012:Arhgef4 UTSW 1 34725106 missense possibly damaging 0.75
R4118:Arhgef4 UTSW 1 34732347 missense probably damaging 0.98
R4133:Arhgef4 UTSW 1 34806104 missense probably damaging 1.00
R4534:Arhgef4 UTSW 1 34723081 missense unknown
R4535:Arhgef4 UTSW 1 34723081 missense unknown
R4581:Arhgef4 UTSW 1 34732124 missense possibly damaging 0.83
R4665:Arhgef4 UTSW 1 34806032 missense possibly damaging 0.89
R4678:Arhgef4 UTSW 1 34722668 missense unknown
R4684:Arhgef4 UTSW 1 34811785 splice site probably null
R4706:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
R4745:Arhgef4 UTSW 1 34807275 missense probably damaging 1.00
R4747:Arhgef4 UTSW 1 34723274 missense unknown
R4988:Arhgef4 UTSW 1 34723454 missense unknown
R5063:Arhgef4 UTSW 1 34724215 missense probably benign 0.00
R5154:Arhgef4 UTSW 1 34732374 missense probably benign 0.43
R5156:Arhgef4 UTSW 1 34723274 missense unknown
R5263:Arhgef4 UTSW 1 34724997 missense possibly damaging 0.84
R5450:Arhgef4 UTSW 1 34807324 intron probably benign
R5807:Arhgef4 UTSW 1 34807615 intron probably benign
R5863:Arhgef4 UTSW 1 34722845 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6311:Arhgef4 UTSW 1 34723981 missense unknown
R6315:Arhgef4 UTSW 1 34723477 missense unknown
R6316:Arhgef4 UTSW 1 34723477 missense unknown
R6318:Arhgef4 UTSW 1 34723477 missense unknown
R6323:Arhgef4 UTSW 1 34723477 missense unknown
R6324:Arhgef4 UTSW 1 34723477 missense unknown
R6325:Arhgef4 UTSW 1 34723477 missense unknown
R6340:Arhgef4 UTSW 1 34732223 missense probably damaging 1.00
R6835:Arhgef4 UTSW 1 34806493 missense probably damaging 1.00
R6981:Arhgef4 UTSW 1 34722452 missense unknown
R7087:Arhgef4 UTSW 1 34811686 missense probably damaging 0.96
R7297:Arhgef4 UTSW 1 34807192 missense probably damaging 1.00
R7525:Arhgef4 UTSW 1 34809704 missense probably damaging 1.00
R7614:Arhgef4 UTSW 1 34732235 missense possibly damaging 0.67
R7693:Arhgef4 UTSW 1 34724141 missense probably benign 0.01
R7892:Arhgef4 UTSW 1 34721804 missense unknown
R7895:Arhgef4 UTSW 1 34806397 missense probably damaging 1.00
R7927:Arhgef4 UTSW 1 34807253 missense probably damaging 1.00
R7965:Arhgef4 UTSW 1 34811681 missense probably benign
R7973:Arhgef4 UTSW 1 34724437 missense possibly damaging 0.83
R7979:Arhgef4 UTSW 1 34721897 missense unknown
R8160:Arhgef4 UTSW 1 34723574 missense unknown
R8175:Arhgef4 UTSW 1 34810374 missense probably benign
R8178:Arhgef4 UTSW 1 34722902 missense unknown
R9046:Arhgef4 UTSW 1 34811765 missense possibly damaging 0.92
R9077:Arhgef4 UTSW 1 34721743 missense unknown
R9209:Arhgef4 UTSW 1 34725160 critical splice donor site probably null
R9209:Arhgef4 UTSW 1 34810495 missense probably benign
R9355:Arhgef4 UTSW 1 34810549 missense probably benign 0.02
R9489:Arhgef4 UTSW 1 34722664 missense unknown
R9509:Arhgef4 UTSW 1 34723691 missense unknown
R9605:Arhgef4 UTSW 1 34722664 missense unknown
R9665:Arhgef4 UTSW 1 34810437 missense probably benign
R9675:Arhgef4 UTSW 1 34806027 missense probably benign
R9790:Arhgef4 UTSW 1 34793364 critical splice donor site probably null
R9791:Arhgef4 UTSW 1 34793364 critical splice donor site probably null
RF012:Arhgef4 UTSW 1 34724484 small deletion probably benign
X0062:Arhgef4 UTSW 1 34724227 missense probably benign 0.35
YA93:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
Z1176:Arhgef4 UTSW 1 34723729 missense unknown
Z1176:Arhgef4 UTSW 1 34804926 missense probably damaging 1.00
Z1177:Arhgef4 UTSW 1 34722921 missense unknown
Z1177:Arhgef4 UTSW 1 34723366 missense unknown
Z1177:Arhgef4 UTSW 1 34724259 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCTTGGCTTCAAGCACCACAAC -3'
(R):5'- GCATCTTTGCTTCTCAGAAACGCAC -3'

Sequencing Primer
(F):5'- AGTTCCAGGAACCATGCG -3'
(R):5'- CCTTTGACAGAGCCAGTATTTG -3'
Posted On 2014-05-23