Mutagenetix > Incidental Mutation

Incidental Mutation 'R1780:Ercc5'

197414

Institutional Source

Beutler Lab

Gene Symbol

Ercc5

Ensembl Gene

ENSMUSG00000026048

Gene Name

excision repair cross-complementing rodent repair deficiency, complementation group 5

Synonyms

Xpg

MMRRC Submission

039811-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1780 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44147744-44181260 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 44167796 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 623 (V623E)

Ref Sequence

ENSEMBL: ENSMUSP00000027214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027214]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027214
AA Change: V623E

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: V623E

Domain	Start	End	E-Value	Type
XPGN	1	98	3.49e-50	SMART
low complexity region	104	115	N/A	INTRINSIC
low complexity region	151	163	N/A	INTRINSIC
low complexity region	305	326	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
low complexity region	641	650	N/A	INTRINSIC
XPGI	776	845	1.02e-33	SMART
HhH2	847	880	2.94e-11	SMART
low complexity region	1130	1140	N/A	INTRINSIC
low complexity region	1155	1169	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131177

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137380

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155862

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.3%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,852,593	E493G	probably damaging	Het
Aff3	A	T	1: 38,535,702	S66T	probably damaging	Het
Ankrd17	T	A	5: 90,232,415	K2470N	probably damaging	Het
Ap3m1	T	C	14: 21,041,070	T156A	probably benign	Het
Arhgef4	T	A	1: 34,724,160	S832R	possibly damaging	Het
Asb10	T	C	5: 24,533,676	D423G	possibly damaging	Het
Ash1l	A	G	3: 88,965,984	T25A	probably benign	Het
Atp13a2	T	A	4: 141,002,460	L663I	possibly damaging	Het
Atp9b	A	T	18: 80,776,897	Y174*	probably null	Het
Bche	A	G	3: 73,700,620	I491T	probably benign	Het
Bckdhb	T	C	9: 83,953,783		probably null	Het
Cadps2	C	T	6: 23,320,932		probably null	Het
Cdc42bpb	A	T	12: 111,322,907	V468E	probably damaging	Het
Chrnd	T	C	1: 87,192,548	V33A	possibly damaging	Het
Col6a5	A	T	9: 105,936,878	V645D	unknown	Het
Cpa1	C	T	6: 30,643,008	L312F	probably damaging	Het
Cyp2a5	A	G	7: 26,841,876		probably benign	Het
Cyp2c39	C	A	19: 39,538,851		probably benign	Het
Cyp2d26	T	C	15: 82,794,007	N56S	probably damaging	Het
Ddx21	A	G	10: 62,594,147		probably benign	Het
Dnah11	A	T	12: 118,027,558	C2358S	probably damaging	Het
Entpd8	T	C	2: 25,084,306	S368P	probably benign	Het
Epg5	A	T	18: 78,023,990	Q2222L	probably damaging	Het
Flg2	A	G	3: 93,202,999	E778G	unknown	Het
Gbe1	C	T	16: 70,495,324	R515*	probably null	Het
Hsd17b6	A	G	10: 127,994,327		probably null	Het
Hyal6	C	T	6: 24,734,032		probably benign	Het
Ifi27l2b	A	G	12: 103,451,319	I203T	probably damaging	Het
Kcnk9	A	C	15: 72,512,401	D309E	unknown	Het
Lrp6	C	T	6: 134,464,451	R1184Q	probably damaging	Het
Mdn1	T	C	4: 32,700,103	F1399L	probably damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Mx1	T	C	16: 97,451,512	*289W	probably null	Het
Myo7b	T	C	18: 31,961,185	E1970G	probably damaging	Het
Mypn	T	C	10: 63,121,964	Y24C	probably damaging	Het
Naxe	G	C	3: 88,057,133	P167A	probably benign	Het
Nmnat2	A	T	1: 153,112,440	K272*	probably null	Het
Nmnat3	C	T	9: 98,354,111	T19M	probably damaging	Het
Olfr1275	T	C	2: 111,231,698	I32V	probably benign	Het
Olfr1412	G	A	1: 92,588,389	V20M	probably benign	Het
Olfr1474	A	G	19: 13,471,362	T131A	probably benign	Het
Olfr64	A	T	7: 103,893,555	F60Y	probably damaging	Het
Olfr66	A	G	7: 103,881,592	V217A	probably benign	Het
Pgm3	T	G	9: 86,556,204	E509D	probably damaging	Het
Phf3	A	T	1: 30,811,942	D1110E	probably damaging	Het
Pkd1	T	G	17: 24,581,569	S3062A	probably benign	Het
Pogz	A	T	3: 94,870,126	K372N	possibly damaging	Het
Pou1f1	A	G	16: 65,523,470	Y15C	probably benign	Het
Ppfia2	A	G	10: 106,896,507	T972A	possibly damaging	Het
Rasip1	A	G	7: 45,635,318	Y703C	possibly damaging	Het
Recql	T	A	6: 142,364,598	Q502L	probably benign	Het
Rgs9	A	T	11: 109,239,499	Y383*	probably null	Het
Rimbp3	T	C	16: 17,212,632	S1307P	probably benign	Het
Rspo1	A	G	4: 125,007,745	T200A	probably damaging	Het
Ryr3	C	T	2: 112,867,292	M922I	probably damaging	Het
Samm50	C	T	15: 84,211,127	A438V	probably damaging	Het
Sec1	A	C	7: 45,678,832	S264A	probably benign	Het
Sec31a	A	T	5: 100,381,336		probably null	Het
Slc13a3	T	C	2: 165,406,699	N553S	unknown	Het
Smg6	T	A	11: 74,946,116	L852Q	probably damaging	Het
Spata13	A	G	14: 60,691,725	N244S	probably damaging	Het
Srbd1	T	C	17: 86,057,685	R648G	probably damaging	Het
Sugct	T	G	13: 17,452,454		probably null	Het
Tmed10	A	G	12: 85,354,879	Y85H	probably damaging	Het
Trim68	A	G	7: 102,684,073	I134T	possibly damaging	Het
Trio	A	G	15: 27,744,038	C2603R	possibly damaging	Het
Tspyl3	G	A	2: 153,225,256	R21W	probably damaging	Het
Ttn	T	C	2: 76,810,699	I11863V	probably null	Het
Ubp1	G	A	9: 113,964,579	A283T	possibly damaging	Het
Ubtf	A	T	11: 102,314,918	F60L	probably damaging	Het
Vmn1r235	T	C	17: 21,261,737	I108T	probably benign	Het
Vmn2r125	T	C	4: 156,351,373	S349P	probably damaging	Het
Vmn2r25	A	G	6: 123,828,465	S478P	probably damaging	Het
Vmn2r88	T	A	14: 51,418,572	V746D	probably damaging	Het
Zcwpw1	A	G	5: 137,796,652	K37E	probably damaging	Het
Zdhhc24	T	C	19: 4,883,766	S284P	probably damaging	Het
Zswim8	C	A	14: 20,716,327	H841N	probably damaging	Het

Other mutations in Ercc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Ercc5	APN	1	44163898	missense	probably damaging	1.00
IGL00782:Ercc5	APN	1	44163935	missense	probably damaging	1.00
IGL01418:Ercc5	APN	1	44167280	missense	probably benign	0.43
IGL01710:Ercc5	APN	1	44164075	missense	probably damaging	1.00
IGL02528:Ercc5	APN	1	44167802	missense	probably benign	0.00
IGL02589:Ercc5	APN	1	44164049	missense	probably damaging	1.00
IGL02651:Ercc5	APN	1	44156944	missense	probably damaging	1.00
IGL02740:Ercc5	APN	1	44167492	missense	probably benign	0.00
IGL02999:Ercc5	APN	1	44167654	missense	probably benign	0.00
IGL03057:Ercc5	APN	1	44167001	missense	probably damaging	0.99
IGL03246:Ercc5	APN	1	44167081	missense	probably damaging	1.00
R0084:Ercc5	UTSW	1	44175976	missense	possibly damaging	0.53
R0448:Ercc5	UTSW	1	44173940	missense	probably damaging	1.00
R1120:Ercc5	UTSW	1	44161841	missense	probably damaging	1.00
R1312:Ercc5	UTSW	1	44164019	missense	probably damaging	1.00
R1411:Ercc5	UTSW	1	44178281	missense	probably damaging	0.99
R1462:Ercc5	UTSW	1	44180624	missense	probably damaging	0.98
R1462:Ercc5	UTSW	1	44180624	missense	probably damaging	0.98
R1528:Ercc5	UTSW	1	44178241	nonsense	probably null
R1637:Ercc5	UTSW	1	44167534	missense	probably benign	0.00
R1668:Ercc5	UTSW	1	44167033	missense	probably benign	0.04
R1714:Ercc5	UTSW	1	44167339	missense	probably benign	0.01
R1800:Ercc5	UTSW	1	44173380	missense	probably benign	0.00
R1835:Ercc5	UTSW	1	44180875	missense	probably benign	0.00
R1836:Ercc5	UTSW	1	44180875	missense	probably benign	0.00
R1886:Ercc5	UTSW	1	44175976	nonsense	probably null
R2344:Ercc5	UTSW	1	44167169	missense	probably benign
R2680:Ercc5	UTSW	1	44156973	missense	probably benign	0.09
R3033:Ercc5	UTSW	1	44180574	missense	possibly damaging	0.83
R3919:Ercc5	UTSW	1	44161931	missense	probably damaging	1.00
R3933:Ercc5	UTSW	1	44167856	missense	probably benign	0.17
R4444:Ercc5	UTSW	1	44158209	frame shift	probably null
R4578:Ercc5	UTSW	1	44148148	missense	probably benign	0.32
R4585:Ercc5	UTSW	1	44158857	missense	probably benign	0.36
R4586:Ercc5	UTSW	1	44158857	missense	probably benign	0.36
R4911:Ercc5	UTSW	1	44166871	missense	possibly damaging	0.66
R4912:Ercc5	UTSW	1	44157057	missense	probably damaging	1.00
R4942:Ercc5	UTSW	1	44175965	missense	probably benign	0.09
R5155:Ercc5	UTSW	1	44180622	missense	probably damaging	1.00
R5975:Ercc5	UTSW	1	44173406	missense	probably benign	0.04
R5991:Ercc5	UTSW	1	44180830	nonsense	probably null
R6161:Ercc5	UTSW	1	44167352	missense	probably benign	0.00
R6250:Ercc5	UTSW	1	44164049	missense	probably damaging	1.00
R7142:Ercc5	UTSW	1	44174214	missense	probably damaging	1.00
R7183:Ercc5	UTSW	1	44161808	critical splice acceptor site	probably null
R7183:Ercc5	UTSW	1	44161809	critical splice acceptor site	probably null
R7235:Ercc5	UTSW	1	44178203	missense	possibly damaging	0.68
R7349:Ercc5	UTSW	1	44180908	missense	possibly damaging	0.56
R7369:Ercc5	UTSW	1	44180860	missense	probably benign	0.39
R7486:Ercc5	UTSW	1	44148064	start codon destroyed	probably null	1.00
R7586:Ercc5	UTSW	1	44175851	missense	possibly damaging	0.49
R7904:Ercc5	UTSW	1	44175838	critical splice acceptor site	probably null
R7994:Ercc5	UTSW	1	44178334	missense	possibly damaging	0.94
R8432:Ercc5	UTSW	1	44167681	nonsense	probably null
R8795:Ercc5	UTSW	1	44163929	missense	possibly damaging	0.92
R9144:Ercc5	UTSW	1	44174351	missense	probably damaging	1.00
R9208:Ercc5	UTSW	1	44178343	missense	possibly damaging	0.51
R9295:Ercc5	UTSW	1	44158857	missense	probably damaging	1.00
R9516:Ercc5	UTSW	1	44167881	missense	probably damaging	1.00
X0011:Ercc5	UTSW	1	44180622	missense	probably damaging	1.00
X0062:Ercc5	UTSW	1	44173974	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GAGACCAAGTGTAATTCCTCTCGCC -3'
(R):5'- TCCTGGATGTGAGTCCCTAGAAAGC -3'

Sequencing Primer
(F):5'- CGCCTTTCAAGTGACGATG -3'
(R):5'- GAGTCCCTAGAAAGCTCATTTATCC -3'

Posted On

2014-05-23