Incidental Mutation 'R1780:Ercc5'
ID 197414
Institutional Source Beutler Lab
Gene Symbol Ercc5
Ensembl Gene ENSMUSG00000026048
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 5
Synonyms Xpg
MMRRC Submission 039811-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1780 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 44186904-44220420 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 44206956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 623 (V623E)
Ref Sequence ENSEMBL: ENSMUSP00000027214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027214
AA Change: V623E

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: V623E

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155862
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,558,229 (GRCm39) E493G probably damaging Het
Aff3 A T 1: 38,574,783 (GRCm39) S66T probably damaging Het
Ankrd17 T A 5: 90,380,274 (GRCm39) K2470N probably damaging Het
Ap3m1 T C 14: 21,091,138 (GRCm39) T156A probably benign Het
Arhgef4 T A 1: 34,763,241 (GRCm39) S832R possibly damaging Het
Asb10 T C 5: 24,738,674 (GRCm39) D423G possibly damaging Het
Ash1l A G 3: 88,873,291 (GRCm39) T25A probably benign Het
Atp13a2 T A 4: 140,729,771 (GRCm39) L663I possibly damaging Het
Atp9b A T 18: 80,820,112 (GRCm39) Y174* probably null Het
Bche A G 3: 73,607,953 (GRCm39) I491T probably benign Het
Bckdhb T C 9: 83,835,836 (GRCm39) probably null Het
Cadps2 C T 6: 23,320,931 (GRCm39) probably null Het
Cdc42bpb A T 12: 111,289,341 (GRCm39) V468E probably damaging Het
Chrnd T C 1: 87,120,270 (GRCm39) V33A possibly damaging Het
Col6a5 A T 9: 105,814,077 (GRCm39) V645D unknown Het
Cpa1 C T 6: 30,643,007 (GRCm39) L312F probably damaging Het
Cyp2a5 A G 7: 26,541,301 (GRCm39) probably benign Het
Cyp2c39 C A 19: 39,527,295 (GRCm39) probably benign Het
Cyp2d26 T C 15: 82,678,208 (GRCm39) N56S probably damaging Het
Ddx21 A G 10: 62,429,926 (GRCm39) probably benign Het
Dnah11 A T 12: 117,991,293 (GRCm39) C2358S probably damaging Het
Entpd8 T C 2: 24,974,318 (GRCm39) S368P probably benign Het
Epg5 A T 18: 78,067,205 (GRCm39) Q2222L probably damaging Het
Flg2 A G 3: 93,110,306 (GRCm39) E778G unknown Het
Gbe1 C T 16: 70,292,212 (GRCm39) R515* probably null Het
Hsd17b6 A G 10: 127,830,196 (GRCm39) probably null Het
Hyal6 C T 6: 24,734,031 (GRCm39) probably benign Het
Ifi27l2b A G 12: 103,417,578 (GRCm39) I203T probably damaging Het
Kcnk9 A C 15: 72,384,250 (GRCm39) D309E unknown Het
Lrp6 C T 6: 134,441,414 (GRCm39) R1184Q probably damaging Het
Mdn1 T C 4: 32,700,103 (GRCm39) F1399L probably damaging Het
Mroh2a C T 1: 88,158,402 (GRCm39) R150* probably null Het
Mx1 T C 16: 97,252,712 (GRCm39) *289W probably null Het
Myo7b T C 18: 32,094,238 (GRCm39) E1970G probably damaging Het
Mypn T C 10: 62,957,743 (GRCm39) Y24C probably damaging Het
Naxe G C 3: 87,964,440 (GRCm39) P167A probably benign Het
Nmnat2 A T 1: 152,988,186 (GRCm39) K272* probably null Het
Nmnat3 C T 9: 98,236,164 (GRCm39) T19M probably damaging Het
Or4f52 T C 2: 111,062,043 (GRCm39) I32V probably benign Het
Or51b17 A T 7: 103,542,762 (GRCm39) F60Y probably damaging Het
Or51b4 A G 7: 103,530,799 (GRCm39) V217A probably benign Het
Or5b118 A G 19: 13,448,726 (GRCm39) T131A probably benign Het
Or9s27 G A 1: 92,516,111 (GRCm39) V20M probably benign Het
Pgm3 T G 9: 86,438,257 (GRCm39) E509D probably damaging Het
Phf3 A T 1: 30,851,023 (GRCm39) D1110E probably damaging Het
Pkd1 T G 17: 24,800,543 (GRCm39) S3062A probably benign Het
Pogz A T 3: 94,777,437 (GRCm39) K372N possibly damaging Het
Pou1f1 A G 16: 65,320,356 (GRCm39) Y15C probably benign Het
Ppfia2 A G 10: 106,732,368 (GRCm39) T972A possibly damaging Het
Rasip1 A G 7: 45,284,742 (GRCm39) Y703C possibly damaging Het
Recql T A 6: 142,310,324 (GRCm39) Q502L probably benign Het
Rgs9 A T 11: 109,130,325 (GRCm39) Y383* probably null Het
Rimbp3 T C 16: 17,030,496 (GRCm39) S1307P probably benign Het
Rspo1 A G 4: 124,901,538 (GRCm39) T200A probably damaging Het
Ryr3 C T 2: 112,697,637 (GRCm39) M922I probably damaging Het
Samm50 C T 15: 84,095,328 (GRCm39) A438V probably damaging Het
Sec1 A C 7: 45,328,256 (GRCm39) S264A probably benign Het
Sec31a A T 5: 100,529,195 (GRCm39) probably null Het
Slc13a3 T C 2: 165,248,619 (GRCm39) N553S unknown Het
Smg6 T A 11: 74,836,942 (GRCm39) L852Q probably damaging Het
Spata13 A G 14: 60,929,174 (GRCm39) N244S probably damaging Het
Srbd1 T C 17: 86,365,113 (GRCm39) R648G probably damaging Het
Sugct T G 13: 17,627,039 (GRCm39) probably null Het
Tmed10 A G 12: 85,401,653 (GRCm39) Y85H probably damaging Het
Trim68 A G 7: 102,333,280 (GRCm39) I134T possibly damaging Het
Trio A G 15: 27,744,124 (GRCm39) C2603R possibly damaging Het
Tspyl3 G A 2: 153,067,176 (GRCm39) R21W probably damaging Het
Ttn T C 2: 76,641,043 (GRCm39) I11863V probably null Het
Ubp1 G A 9: 113,793,647 (GRCm39) A283T possibly damaging Het
Ubtf A T 11: 102,205,744 (GRCm39) F60L probably damaging Het
Vmn1r235 T C 17: 21,481,999 (GRCm39) I108T probably benign Het
Vmn2r125 T C 4: 156,703,668 (GRCm39) S349P probably damaging Het
Vmn2r25 A G 6: 123,805,424 (GRCm39) S478P probably damaging Het
Vmn2r88 T A 14: 51,656,029 (GRCm39) V746D probably damaging Het
Zcwpw1 A G 5: 137,794,914 (GRCm39) K37E probably damaging Het
Zdhhc24 T C 19: 4,933,794 (GRCm39) S284P probably damaging Het
Zswim8 C A 14: 20,766,395 (GRCm39) H841N probably damaging Het
Other mutations in Ercc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ercc5 APN 1 44,203,058 (GRCm39) missense probably damaging 1.00
IGL00782:Ercc5 APN 1 44,203,095 (GRCm39) missense probably damaging 1.00
IGL01418:Ercc5 APN 1 44,206,440 (GRCm39) missense probably benign 0.43
IGL01710:Ercc5 APN 1 44,203,235 (GRCm39) missense probably damaging 1.00
IGL02528:Ercc5 APN 1 44,206,962 (GRCm39) missense probably benign 0.00
IGL02589:Ercc5 APN 1 44,203,209 (GRCm39) missense probably damaging 1.00
IGL02651:Ercc5 APN 1 44,196,104 (GRCm39) missense probably damaging 1.00
IGL02740:Ercc5 APN 1 44,206,652 (GRCm39) missense probably benign 0.00
IGL02999:Ercc5 APN 1 44,206,814 (GRCm39) missense probably benign 0.00
IGL03057:Ercc5 APN 1 44,206,161 (GRCm39) missense probably damaging 0.99
IGL03246:Ercc5 APN 1 44,206,241 (GRCm39) missense probably damaging 1.00
R0084:Ercc5 UTSW 1 44,215,136 (GRCm39) missense possibly damaging 0.53
R0448:Ercc5 UTSW 1 44,213,100 (GRCm39) missense probably damaging 1.00
R1120:Ercc5 UTSW 1 44,201,001 (GRCm39) missense probably damaging 1.00
R1312:Ercc5 UTSW 1 44,203,179 (GRCm39) missense probably damaging 1.00
R1411:Ercc5 UTSW 1 44,217,441 (GRCm39) missense probably damaging 0.99
R1462:Ercc5 UTSW 1 44,219,784 (GRCm39) missense probably damaging 0.98
R1462:Ercc5 UTSW 1 44,219,784 (GRCm39) missense probably damaging 0.98
R1528:Ercc5 UTSW 1 44,217,401 (GRCm39) nonsense probably null
R1637:Ercc5 UTSW 1 44,206,694 (GRCm39) missense probably benign 0.00
R1668:Ercc5 UTSW 1 44,206,193 (GRCm39) missense probably benign 0.04
R1714:Ercc5 UTSW 1 44,206,499 (GRCm39) missense probably benign 0.01
R1800:Ercc5 UTSW 1 44,212,540 (GRCm39) missense probably benign 0.00
R1835:Ercc5 UTSW 1 44,220,035 (GRCm39) missense probably benign 0.00
R1836:Ercc5 UTSW 1 44,220,035 (GRCm39) missense probably benign 0.00
R1886:Ercc5 UTSW 1 44,215,136 (GRCm39) nonsense probably null
R2344:Ercc5 UTSW 1 44,206,329 (GRCm39) missense probably benign
R2680:Ercc5 UTSW 1 44,196,133 (GRCm39) missense probably benign 0.09
R3033:Ercc5 UTSW 1 44,219,734 (GRCm39) missense possibly damaging 0.83
R3919:Ercc5 UTSW 1 44,201,091 (GRCm39) missense probably damaging 1.00
R3933:Ercc5 UTSW 1 44,207,016 (GRCm39) missense probably benign 0.17
R4444:Ercc5 UTSW 1 44,197,369 (GRCm39) frame shift probably null
R4578:Ercc5 UTSW 1 44,187,308 (GRCm39) missense probably benign 0.32
R4585:Ercc5 UTSW 1 44,198,017 (GRCm39) missense probably benign 0.36
R4586:Ercc5 UTSW 1 44,198,017 (GRCm39) missense probably benign 0.36
R4911:Ercc5 UTSW 1 44,206,031 (GRCm39) missense possibly damaging 0.66
R4912:Ercc5 UTSW 1 44,196,217 (GRCm39) missense probably damaging 1.00
R4942:Ercc5 UTSW 1 44,215,125 (GRCm39) missense probably benign 0.09
R5155:Ercc5 UTSW 1 44,219,782 (GRCm39) missense probably damaging 1.00
R5975:Ercc5 UTSW 1 44,212,566 (GRCm39) missense probably benign 0.04
R5991:Ercc5 UTSW 1 44,219,990 (GRCm39) nonsense probably null
R6161:Ercc5 UTSW 1 44,206,512 (GRCm39) missense probably benign 0.00
R6250:Ercc5 UTSW 1 44,203,209 (GRCm39) missense probably damaging 1.00
R7142:Ercc5 UTSW 1 44,213,374 (GRCm39) missense probably damaging 1.00
R7183:Ercc5 UTSW 1 44,200,969 (GRCm39) critical splice acceptor site probably null
R7183:Ercc5 UTSW 1 44,200,968 (GRCm39) critical splice acceptor site probably null
R7235:Ercc5 UTSW 1 44,217,363 (GRCm39) missense possibly damaging 0.68
R7349:Ercc5 UTSW 1 44,220,068 (GRCm39) missense possibly damaging 0.56
R7369:Ercc5 UTSW 1 44,220,020 (GRCm39) missense probably benign 0.39
R7486:Ercc5 UTSW 1 44,187,224 (GRCm39) start codon destroyed probably null 1.00
R7586:Ercc5 UTSW 1 44,215,011 (GRCm39) missense possibly damaging 0.49
R7904:Ercc5 UTSW 1 44,214,998 (GRCm39) critical splice acceptor site probably null
R7994:Ercc5 UTSW 1 44,217,494 (GRCm39) missense possibly damaging 0.94
R8432:Ercc5 UTSW 1 44,206,841 (GRCm39) nonsense probably null
R8795:Ercc5 UTSW 1 44,203,089 (GRCm39) missense possibly damaging 0.92
R9144:Ercc5 UTSW 1 44,213,511 (GRCm39) missense probably damaging 1.00
R9208:Ercc5 UTSW 1 44,217,503 (GRCm39) missense possibly damaging 0.51
R9295:Ercc5 UTSW 1 44,198,017 (GRCm39) missense probably damaging 1.00
R9516:Ercc5 UTSW 1 44,207,041 (GRCm39) missense probably damaging 1.00
X0011:Ercc5 UTSW 1 44,219,782 (GRCm39) missense probably damaging 1.00
X0062:Ercc5 UTSW 1 44,213,134 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGACCAAGTGTAATTCCTCTCGCC -3'
(R):5'- TCCTGGATGTGAGTCCCTAGAAAGC -3'

Sequencing Primer
(F):5'- CGCCTTTCAAGTGACGATG -3'
(R):5'- GAGTCCCTAGAAAGCTCATTTATCC -3'
Posted On 2014-05-23