Incidental Mutation 'R0083:Col4a4'
ID19742
Institutional Source Beutler Lab
Gene Symbol Col4a4
Ensembl Gene ENSMUSG00000067158
Gene Namecollagen, type IV, alpha 4
SynonymsE130010M05Rik, [a]4(IV)
MMRRC Submission 038370-MU
Accession Numbers

Genbank: NM_007735; MGI: 104687

Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0083 (G1)
Quality Score214
Status Validated
Chromosome1
Chromosomal Location82448423-82586849 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 82507111 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087050] [ENSMUST00000087050]
Predicted Effect probably null
Transcript: ENSMUST00000087050
SMART Domains Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
Pfam:Collagen 54 113 4e-11 PFAM
Pfam:Collagen 110 168 4.1e-10 PFAM
Pfam:Collagen 172 229 2.8e-10 PFAM
low complexity region 265 288 N/A INTRINSIC
internal_repeat_7 289 345 1.46e-9 PROSPERO
internal_repeat_6 291 348 5.03e-10 PROSPERO
internal_repeat_9 297 353 7.22e-9 PROSPERO
internal_repeat_4 322 354 2.06e-11 PROSPERO
internal_repeat_11 334 349 1.25e-5 PROSPERO
Pfam:Collagen 392 449 1.3e-8 PFAM
low complexity region 461 482 N/A INTRINSIC
Pfam:Collagen 486 553 1e-10 PFAM
low complexity region 563 595 N/A INTRINSIC
Pfam:Collagen 597 658 1e-8 PFAM
Pfam:Collagen 663 731 4.4e-10 PFAM
Pfam:Collagen 755 810 3.3e-9 PFAM
internal_repeat_2 816 841 2.9e-13 PROSPERO
Pfam:Collagen 844 912 1.8e-10 PFAM
Pfam:Collagen 898 962 2.7e-10 PFAM
low complexity region 963 1003 N/A INTRINSIC
Pfam:Collagen 1006 1071 2e-10 PFAM
Pfam:Collagen 1073 1132 5.8e-12 PFAM
Pfam:Collagen 1124 1185 1.8e-10 PFAM
Pfam:Collagen 1187 1245 2.3e-8 PFAM
low complexity region 1277 1361 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
Pfam:Collagen 1395 1454 4.3e-8 PFAM
C4 1457 1564 3.36e-58 SMART
C4 1565 1681 1.49e-59 SMART
Predicted Effect probably null
Transcript: ENSMUST00000087050
SMART Domains Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
Pfam:Collagen 54 113 4e-11 PFAM
Pfam:Collagen 110 168 4.1e-10 PFAM
Pfam:Collagen 172 229 2.8e-10 PFAM
low complexity region 265 288 N/A INTRINSIC
internal_repeat_7 289 345 1.46e-9 PROSPERO
internal_repeat_6 291 348 5.03e-10 PROSPERO
internal_repeat_9 297 353 7.22e-9 PROSPERO
internal_repeat_4 322 354 2.06e-11 PROSPERO
internal_repeat_11 334 349 1.25e-5 PROSPERO
Pfam:Collagen 392 449 1.3e-8 PFAM
low complexity region 461 482 N/A INTRINSIC
Pfam:Collagen 486 553 1e-10 PFAM
low complexity region 563 595 N/A INTRINSIC
Pfam:Collagen 597 658 1e-8 PFAM
Pfam:Collagen 663 731 4.4e-10 PFAM
Pfam:Collagen 755 810 3.3e-9 PFAM
internal_repeat_2 816 841 2.9e-13 PROSPERO
Pfam:Collagen 844 912 1.8e-10 PFAM
Pfam:Collagen 898 962 2.7e-10 PFAM
low complexity region 963 1003 N/A INTRINSIC
Pfam:Collagen 1006 1071 2e-10 PFAM
Pfam:Collagen 1073 1132 5.8e-12 PFAM
Pfam:Collagen 1124 1185 1.8e-10 PFAM
Pfam:Collagen 1187 1245 2.3e-8 PFAM
low complexity region 1277 1361 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
Pfam:Collagen 1395 1454 4.3e-8 PFAM
C4 1457 1564 3.36e-58 SMART
C4 1565 1681 1.49e-59 SMART
Meta Mutation Damage Score 0.458 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation develop an early nephritic syndrome associated with uremia, proteinuria, hematuria, leukocyturia, and focal segmental glomerulosclerosis, and die prematurely of kidney failure. Some homozygotes exhibit moderatesensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Ccdc88a T A 11: 29,503,463 S337T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col22a1 A T 15: 71,890,497 D104E possibly damaging Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fbxw10 A G 11: 62,877,061 T903A probably benign Het
Fkbp4 G A 6: 128,432,407 probably benign Het
Gatad2b T A 3: 90,357,943 Y576N probably damaging Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Myh14 A G 7: 44,634,519 V654A probably damaging Het
Neu2 A G 1: 87,597,262 Y323C probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Olfr1491 A T 19: 13,705,678 T284S probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sap130 C A 18: 31,666,329 probably benign Het
Sap130 C T 18: 31,711,641 P902S probably damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slc30a5 G T 13: 100,803,400 A669E probably damaging Het
Sppl2c G A 11: 104,186,532 V53I probably benign Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Sulf1 A G 1: 12,817,417 M272V probably damaging Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Col4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col4a4 APN 1 82491641 missense unknown
IGL01092:Col4a4 APN 1 82466545 missense unknown
IGL01104:Col4a4 APN 1 82466545 missense unknown
IGL01413:Col4a4 APN 1 82471248 missense unknown
IGL01518:Col4a4 APN 1 82455759 missense unknown
IGL02014:Col4a4 APN 1 82523960 splice site probably benign
IGL02215:Col4a4 APN 1 82453809 missense unknown
IGL02707:Col4a4 APN 1 82493516 missense unknown
IGL02858:Col4a4 APN 1 82528483 missense unknown
IGL02987:Col4a4 APN 1 82498925 splice site probably benign
IGL03384:Col4a4 APN 1 82484438 missense probably benign 0.04
amazement UTSW 1 82480486 nonsense probably null
aoba UTSW 1 82535740 critical splice donor site probably benign
asombro UTSW 1 82489009 critical splice donor site probably null
astonishment UTSW 1 82455728 missense unknown
wonderment UTSW 1 82453144 missense unknown
IGL02980:Col4a4 UTSW 1 82469477 critical splice donor site probably null
R0028:Col4a4 UTSW 1 82487510 critical splice donor site probably null
R0696:Col4a4 UTSW 1 82492549 missense unknown
R0788:Col4a4 UTSW 1 82524996 missense unknown
R0789:Col4a4 UTSW 1 82524996 missense unknown
R0790:Col4a4 UTSW 1 82524996 missense unknown
R0894:Col4a4 UTSW 1 82529656 splice site probably null
R1217:Col4a4 UTSW 1 82489009 critical splice donor site probably null
R1465:Col4a4 UTSW 1 82497822 splice site probably null
R1465:Col4a4 UTSW 1 82497822 splice site probably null
R1474:Col4a4 UTSW 1 82480486 nonsense probably null
R1508:Col4a4 UTSW 1 82455836 missense unknown
R1640:Col4a4 UTSW 1 82535770 missense unknown
R1678:Col4a4 UTSW 1 82486659 missense unknown
R1827:Col4a4 UTSW 1 82539988 missense unknown
R1930:Col4a4 UTSW 1 82466600 splice site probably null
R1931:Col4a4 UTSW 1 82466600 splice site probably null
R2092:Col4a4 UTSW 1 82498946 missense unknown
R2122:Col4a4 UTSW 1 82456871 missense unknown
R2132:Col4a4 UTSW 1 82497860 missense unknown
R2396:Col4a4 UTSW 1 82507072 missense unknown
R2418:Col4a4 UTSW 1 82532936 missense unknown
R2679:Col4a4 UTSW 1 82529611 missense unknown
R3085:Col4a4 UTSW 1 82529564 critical splice donor site probably null
R3437:Col4a4 UTSW 1 82497168 missense unknown
R3697:Col4a4 UTSW 1 82541237 missense unknown
R3730:Col4a4 UTSW 1 82455751 synonymous probably null
R3752:Col4a4 UTSW 1 82480494 missense probably damaging 0.97
R4085:Col4a4 UTSW 1 82471188 critical splice donor site probably null
R4087:Col4a4 UTSW 1 82523922 missense unknown
R4088:Col4a4 UTSW 1 82523922 missense unknown
R4090:Col4a4 UTSW 1 82523922 missense unknown
R4213:Col4a4 UTSW 1 82453144 missense unknown
R4422:Col4a4 UTSW 1 82489838 missense unknown
R4596:Col4a4 UTSW 1 82471219 missense unknown
R4755:Col4a4 UTSW 1 82541174 missense unknown
R4757:Col4a4 UTSW 1 82528466 missense unknown
R4793:Col4a4 UTSW 1 82539099 missense unknown
R4812:Col4a4 UTSW 1 82462153 missense unknown
R4833:Col4a4 UTSW 1 82529602 missense unknown
R5259:Col4a4 UTSW 1 82453893 missense unknown
R5264:Col4a4 UTSW 1 82493591 missense unknown
R5265:Col4a4 UTSW 1 82493591 missense unknown
R5281:Col4a4 UTSW 1 82493591 missense unknown
R5283:Col4a4 UTSW 1 82493591 missense unknown
R5284:Col4a4 UTSW 1 82493591 missense unknown
R5387:Col4a4 UTSW 1 82493591 missense unknown
R5388:Col4a4 UTSW 1 82493591 missense unknown
R5435:Col4a4 UTSW 1 82454007 missense unknown
R5534:Col4a4 UTSW 1 82487517 missense unknown
R5666:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5670:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5943:Col4a4 UTSW 1 82525016 missense unknown
R5996:Col4a4 UTSW 1 82455728 missense unknown
R5999:Col4a4 UTSW 1 82492619 missense unknown
R6112:Col4a4 UTSW 1 82453883 missense unknown
R6192:Col4a4 UTSW 1 82484430 missense probably damaging 1.00
R6237:Col4a4 UTSW 1 82507031 missense unknown
R6419:Col4a4 UTSW 1 82466486 critical splice donor site probably null
R6458:Col4a4 UTSW 1 82455825 missense unknown
R6460:Col4a4 UTSW 1 82466532 missense unknown
R6481:Col4a4 UTSW 1 82453778 missense unknown
R6522:Col4a4 UTSW 1 82487583 missense unknown
R7000:Col4a4 UTSW 1 82497330 missense unknown
R7015:Col4a4 UTSW 1 82506950 missense unknown
R7055:Col4a4 UTSW 1 82519036 missense unknown
R7288:Col4a4 UTSW 1 82492463 missense unknown
R7293:Col4a4 UTSW 1 82523943 missense unknown
R7300:Col4a4 UTSW 1 82486640 missense unknown
R7458:Col4a4 UTSW 1 82498948 missense unknown
R7520:Col4a4 UTSW 1 82507087 nonsense probably null
X0020:Col4a4 UTSW 1 82539952 critical splice donor site probably null
Z1088:Col4a4 UTSW 1 82453196 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAAAGGGGCACACTAGGTTCTCTC -3'
(R):5'- TTCTGTCACATGGTACACACCAGC -3'

Sequencing Primer
(F):5'- ACACTAGGTTCTCTCTGTGCC -3'
(R):5'- AGCCACATATCACATGGTCTC -3'
Posted On2013-04-11