Mutagenetix > Incidental Mutation

Incidental Mutation 'R1780:Adgrl2'

197431

Institutional Source

Beutler Lab

Gene Symbol

Adgrl2

Ensembl Gene

ENSMUSG00000028184

Gene Name

adhesion G protein-coupled receptor L2

Synonyms

Lec1, Lphn2, Lphh1

MMRRC Submission

039811-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1780 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

148815583-148990555 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 148852593 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 493 (E493G)

Ref Sequence

ENSEMBL: ENSMUSP00000142405 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106128] [ENSMUST00000195988] [ENSMUST00000196526] [ENSMUST00000197567] [ENSMUST00000198779] [ENSMUST00000199059] [ENSMUST00000199238] [ENSMUST00000199750] [ENSMUST00000200154] [ENSMUST00000200543]

AlphaFold

Q8JZZ7

Predicted Effect

probably damaging
Transcript: ENSMUST00000106128
AA Change: E493G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000101734
Gene: ENSMUSG00000028184
AA Change: E493G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	2.5e-26	PFAM
OLF	142	398	5.22e-140	SMART
HormR	469	534	3.14e-20	SMART
Pfam:GAIN	537	764	1.3e-58	PFAM
GPS	788	840	3.47e-25	SMART
Pfam:7tm_2	848	1108	4.6e-69	PFAM
Pfam:Latrophilin	1128	1487	6.4e-181	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000195988
AA Change: E493G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143444
Gene: ENSMUSG00000028184
AA Change: E493G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.3e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1099	8.1e-66	PFAM
Pfam:Latrophilin	1119	1189	2.2e-28	PFAM
Pfam:Latrophilin	1184	1435	5.5e-123	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000196526
AA Change: E489G

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000143788
Gene: ENSMUSG00000028184
AA Change: E489G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	8.7e-24	PFAM
OLF	138	394	3.4e-142	SMART
HormR	465	530	2e-22	SMART
Pfam:GAIN	533	747	1.1e-54	PFAM
GPS	771	823	2.2e-27	SMART
Pfam:7tm_2	831	1067	6.5e-68	PFAM
Pfam:Latrophilin	1087	1158	9.9e-36	PFAM
low complexity region	1163	1173	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000197567
AA Change: E493G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143626
Gene: ENSMUSG00000028184
AA Change: E493G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	1.9e-26	PFAM
OLF	142	398	5.22e-140	SMART
HormR	469	534	3.14e-20	SMART
Pfam:GAIN	537	764	1.1e-58	PFAM
GPS	788	840	3.47e-25	SMART
Pfam:7tm_2	848	1108	6.4e-69	PFAM
Pfam:Latrophilin	1128	1487	2.8e-181	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000198779
AA Change: E493G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000142347
Gene: ENSMUSG00000028184
AA Change: E493G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.4e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1084	1.8e-66	PFAM
Pfam:Latrophilin	1104	1452	7e-174	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000199059
AA Change: E493G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000143150
Gene: ENSMUSG00000028184
AA Change: E493G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.4e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1099	8.3e-66	PFAM
Pfam:Latrophilin	1119	1467	7.1e-174	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000199238
AA Change: E493G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142405
Gene: ENSMUSG00000028184
AA Change: E493G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.4e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1099	8.4e-66	PFAM
Pfam:Latrophilin	1119	1478	1.6e-187	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000199750
AA Change: E427G

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000143320
Gene: ENSMUSG00000028184
AA Change: E427G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.1e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	403	468	1.9e-22	SMART
GPS	709	761	2.1e-27	SMART
Pfam:7tm_2	769	1005	1.6e-66	PFAM
Pfam:Latrophilin	1025	1095	2e-28	PFAM
Pfam:Latrophilin	1090	1341	4.9e-123	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000200154
AA Change: E489G

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000142865
Gene: ENSMUSG00000028184
AA Change: E489G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	2.5e-23	PFAM
OLF	138	394	3.3e-142	SMART
HormR	465	530	2e-22	SMART
GPS	771	823	2.1e-27	SMART
Pfam:7tm_2	831	1067	1.2e-66	PFAM
Pfam:Latrophilin	1087	1123	2.2e-4	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000200543
AA Change: E489G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000142336
Gene: ENSMUSG00000028184
AA Change: E489G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.2e-23	PFAM
OLF	138	394	3.3e-142	SMART
HormR	465	530	2e-22	SMART
GPS	771	823	2.1e-27	SMART
Pfam:7tm_2	831	1067	1.7e-66	PFAM
Pfam:Latrophilin	1087	1157	2.1e-28	PFAM
Pfam:Latrophilin	1152	1403	5.3e-123	PFAM

Meta Mutation Damage Score

0.4539

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.3%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors. The encoded protein participates in the regulation of exocytosis. The proprotein is thought to be further cleaved within a cysteine-rich G-protein-coupled receptor proteolysis site into two chains that are non-covalently bound at the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice die prenatally at fetal stages. Heterozygous mice exhibit decreased locomotor activity in an open field test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aff3	A	T	1: 38,535,702	S66T	probably damaging	Het
Ankrd17	T	A	5: 90,232,415	K2470N	probably damaging	Het
Ap3m1	T	C	14: 21,041,070	T156A	probably benign	Het
Arhgef4	T	A	1: 34,724,160	S832R	possibly damaging	Het
Asb10	T	C	5: 24,533,676	D423G	possibly damaging	Het
Ash1l	A	G	3: 88,965,984	T25A	probably benign	Het
Atp13a2	T	A	4: 141,002,460	L663I	possibly damaging	Het
Atp9b	A	T	18: 80,776,897	Y174*	probably null	Het
Bche	A	G	3: 73,700,620	I491T	probably benign	Het
Bckdhb	T	C	9: 83,953,783		probably null	Het
Cadps2	C	T	6: 23,320,932		probably null	Het
Cdc42bpb	A	T	12: 111,322,907	V468E	probably damaging	Het
Chrnd	T	C	1: 87,192,548	V33A	possibly damaging	Het
Col6a5	A	T	9: 105,936,878	V645D	unknown	Het
Cpa1	C	T	6: 30,643,008	L312F	probably damaging	Het
Cyp2a5	A	G	7: 26,841,876		probably benign	Het
Cyp2c39	C	A	19: 39,538,851		probably benign	Het
Cyp2d26	T	C	15: 82,794,007	N56S	probably damaging	Het
Ddx21	A	G	10: 62,594,147		probably benign	Het
Dnah11	A	T	12: 118,027,558	C2358S	probably damaging	Het
Entpd8	T	C	2: 25,084,306	S368P	probably benign	Het
Epg5	A	T	18: 78,023,990	Q2222L	probably damaging	Het
Ercc5	T	A	1: 44,167,796	V623E	probably benign	Het
Flg2	A	G	3: 93,202,999	E778G	unknown	Het
Gbe1	C	T	16: 70,495,324	R515*	probably null	Het
Hsd17b6	A	G	10: 127,994,327		probably null	Het
Hyal6	C	T	6: 24,734,032		probably benign	Het
Ifi27l2b	A	G	12: 103,451,319	I203T	probably damaging	Het
Kcnk9	A	C	15: 72,512,401	D309E	unknown	Het
Lrp6	C	T	6: 134,464,451	R1184Q	probably damaging	Het
Mdn1	T	C	4: 32,700,103	F1399L	probably damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Mx1	T	C	16: 97,451,512	*289W	probably null	Het
Myo7b	T	C	18: 31,961,185	E1970G	probably damaging	Het
Mypn	T	C	10: 63,121,964	Y24C	probably damaging	Het
Naxe	G	C	3: 88,057,133	P167A	probably benign	Het
Nmnat2	A	T	1: 153,112,440	K272*	probably null	Het
Nmnat3	C	T	9: 98,354,111	T19M	probably damaging	Het
Olfr1275	T	C	2: 111,231,698	I32V	probably benign	Het
Olfr1412	G	A	1: 92,588,389	V20M	probably benign	Het
Olfr1474	A	G	19: 13,471,362	T131A	probably benign	Het
Olfr64	A	T	7: 103,893,555	F60Y	probably damaging	Het
Olfr66	A	G	7: 103,881,592	V217A	probably benign	Het
Pgm3	T	G	9: 86,556,204	E509D	probably damaging	Het
Phf3	A	T	1: 30,811,942	D1110E	probably damaging	Het
Pkd1	T	G	17: 24,581,569	S3062A	probably benign	Het
Pogz	A	T	3: 94,870,126	K372N	possibly damaging	Het
Pou1f1	A	G	16: 65,523,470	Y15C	probably benign	Het
Ppfia2	A	G	10: 106,896,507	T972A	possibly damaging	Het
Rasip1	A	G	7: 45,635,318	Y703C	possibly damaging	Het
Recql	T	A	6: 142,364,598	Q502L	probably benign	Het
Rgs9	A	T	11: 109,239,499	Y383*	probably null	Het
Rimbp3	T	C	16: 17,212,632	S1307P	probably benign	Het
Rspo1	A	G	4: 125,007,745	T200A	probably damaging	Het
Ryr3	C	T	2: 112,867,292	M922I	probably damaging	Het
Samm50	C	T	15: 84,211,127	A438V	probably damaging	Het
Sec1	A	C	7: 45,678,832	S264A	probably benign	Het
Sec31a	A	T	5: 100,381,336		probably null	Het
Slc13a3	T	C	2: 165,406,699	N553S	unknown	Het
Smg6	T	A	11: 74,946,116	L852Q	probably damaging	Het
Spata13	A	G	14: 60,691,725	N244S	probably damaging	Het
Srbd1	T	C	17: 86,057,685	R648G	probably damaging	Het
Sugct	T	G	13: 17,452,454		probably null	Het
Tmed10	A	G	12: 85,354,879	Y85H	probably damaging	Het
Trim68	A	G	7: 102,684,073	I134T	possibly damaging	Het
Trio	A	G	15: 27,744,038	C2603R	possibly damaging	Het
Tspyl3	G	A	2: 153,225,256	R21W	probably damaging	Het
Ttn	T	C	2: 76,810,699	I11863V	probably null	Het
Ubp1	G	A	9: 113,964,579	A283T	possibly damaging	Het
Ubtf	A	T	11: 102,314,918	F60L	probably damaging	Het
Vmn1r235	T	C	17: 21,261,737	I108T	probably benign	Het
Vmn2r125	T	C	4: 156,351,373	S349P	probably damaging	Het
Vmn2r25	A	G	6: 123,828,465	S478P	probably damaging	Het
Vmn2r88	T	A	14: 51,418,572	V746D	probably damaging	Het
Zcwpw1	A	G	5: 137,796,652	K37E	probably damaging	Het
Zdhhc24	T	C	19: 4,883,766	S284P	probably damaging	Het
Zswim8	C	A	14: 20,716,327	H841N	probably damaging	Het

Other mutations in Adgrl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Adgrl2	APN	3	148865608	missense	probably damaging	0.99
IGL00572:Adgrl2	APN	3	148826498	missense	probably damaging	1.00
IGL01624:Adgrl2	APN	3	148836527	missense	probably damaging	1.00
IGL01796:Adgrl2	APN	3	148858975	missense	probably damaging	1.00
IGL02380:Adgrl2	APN	3	148828489	nonsense	probably null
IGL02468:Adgrl2	APN	3	148890480	missense	probably damaging	1.00
IGL02708:Adgrl2	APN	3	148826525	missense	probably damaging	0.96
IGL02869:Adgrl2	APN	3	148890605	missense	probably damaging	1.00
IGL03248:Adgrl2	APN	3	148817400	missense	probably damaging	1.00
IGL03343:Adgrl2	APN	3	148859380	missense	probably damaging	0.98
P0157:Adgrl2	UTSW	3	148859063	missense	probably damaging	1.00
PIT4382001:Adgrl2	UTSW	3	148817298	missense
PIT4544001:Adgrl2	UTSW	3	148890521	missense	probably damaging	1.00
R0165:Adgrl2	UTSW	3	148852863	splice site	probably benign
R0242:Adgrl2	UTSW	3	148839185	splice site	probably null
R0242:Adgrl2	UTSW	3	148839185	splice site	probably null
R0344:Adgrl2	UTSW	3	148865595	splice site	probably null
R0488:Adgrl2	UTSW	3	148846905	missense	probably damaging	1.00
R0542:Adgrl2	UTSW	3	148859218	missense	probably damaging	1.00
R0630:Adgrl2	UTSW	3	148839244	missense	probably damaging	0.98
R0674:Adgrl2	UTSW	3	148837679	missense	possibly damaging	0.91
R1401:Adgrl2	UTSW	3	148822981	missense	probably damaging	0.99
R1543:Adgrl2	UTSW	3	148859273	missense	probably damaging	1.00
R1575:Adgrl2	UTSW	3	148852762	missense	probably benign	0.17
R1645:Adgrl2	UTSW	3	148865608	missense	probably damaging	1.00
R1992:Adgrl2	UTSW	3	148817244	missense	possibly damaging	0.89
R2014:Adgrl2	UTSW	3	148826475	missense	probably damaging	1.00
R2130:Adgrl2	UTSW	3	148890488	missense	probably damaging	0.99
R2131:Adgrl2	UTSW	3	148890488	missense	probably damaging	0.99
R2400:Adgrl2	UTSW	3	148851934	missense	probably damaging	1.00
R2997:Adgrl2	UTSW	3	148817649	missense	probably damaging	1.00
R3161:Adgrl2	UTSW	3	148817551	missense	probably damaging	1.00
R3416:Adgrl2	UTSW	3	148859329	missense	probably damaging	1.00
R3417:Adgrl2	UTSW	3	148859329	missense	probably damaging	1.00
R3551:Adgrl2	UTSW	3	148858963	missense	probably damaging	1.00
R3760:Adgrl2	UTSW	3	148817235	missense	probably damaging	1.00
R4355:Adgrl2	UTSW	3	148839152	missense	probably damaging	1.00
R4850:Adgrl2	UTSW	3	148859020	missense	probably damaging	1.00
R4911:Adgrl2	UTSW	3	148890463	missense	probably damaging	0.99
R4945:Adgrl2	UTSW	3	148823036	missense	probably damaging	0.99
R5313:Adgrl2	UTSW	3	148823713	missense	probably damaging	1.00
R5339:Adgrl2	UTSW	3	148817844	missense	probably benign	0.01
R5540:Adgrl2	UTSW	3	148837562	critical splice donor site	probably null
R5583:Adgrl2	UTSW	3	148859164	missense	probably damaging	1.00
R5890:Adgrl2	UTSW	3	148859175	missense	probably damaging	1.00
R6170:Adgrl2	UTSW	3	148823009	missense	probably damaging	1.00
R6197:Adgrl2	UTSW	3	148858942	missense	probably damaging	1.00
R6284:Adgrl2	UTSW	3	148826507	missense	probably damaging	1.00
R6877:Adgrl2	UTSW	3	148817286	missense	probably damaging	1.00
R7048:Adgrl2	UTSW	3	148846929	missense	probably damaging	1.00
R7205:Adgrl2	UTSW	3	148858949	missense	probably damaging	1.00
R7326:Adgrl2	UTSW	3	148846870	missense	probably benign	0.00
R7348:Adgrl2	UTSW	3	148817766	missense
R7382:Adgrl2	UTSW	3	148817283	missense
R7486:Adgrl2	UTSW	3	148817694	missense
R7498:Adgrl2	UTSW	3	148859216	nonsense	probably null
R7644:Adgrl2	UTSW	3	148839153	missense	probably damaging	1.00
R7690:Adgrl2	UTSW	3	148817298	missense
R7742:Adgrl2	UTSW	3	148836428	missense	probably damaging	1.00
R7745:Adgrl2	UTSW	3	148836458	missense	probably damaging	1.00
R8291:Adgrl2	UTSW	3	148850918	missense	possibly damaging	0.93
R8326:Adgrl2	UTSW	3	148827554	missense
R8343:Adgrl2	UTSW	3	148846906	missense	probably damaging	1.00
R8344:Adgrl2	UTSW	3	148859525	missense	probably damaging	0.98
R8487:Adgrl2	UTSW	3	148859486	missense	probably benign	0.06
R8748:Adgrl2	UTSW	3	148826390	missense
R8769:Adgrl2	UTSW	3	148817281	missense
R8804:Adgrl2	UTSW	3	148847016	missense	probably damaging	1.00
R8911:Adgrl2	UTSW	3	148852527	intron	probably benign
R8943:Adgrl2	UTSW	3	148828483	missense	probably damaging	1.00
R8977:Adgrl2	UTSW	3	148954587	missense	probably null
R9030:Adgrl2	UTSW	3	148839125	missense	possibly damaging	0.74
R9105:Adgrl2	UTSW	3	148837653	missense	possibly damaging	0.82
R9427:Adgrl2	UTSW	3	148820432	missense
R9471:Adgrl2	UTSW	3	148852729	missense	probably benign
R9646:Adgrl2	UTSW	3	148839290	missense	probably damaging	0.96
R9742:Adgrl2	UTSW	3	148836350	critical splice donor site	probably null
RF007:Adgrl2	UTSW	3	148839248	missense	probably damaging	1.00
X0009:Adgrl2	UTSW	3	148852654	missense	probably damaging	1.00
X0019:Adgrl2	UTSW	3	148865594	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GTTCTGTGCCTGACCTAAGTGACAC -3'
(R):5'- CGAGATCCAGGATCACCTTTTAGCC -3'

Sequencing Primer
(F):5'- TGTTAGaaaaacaacaacaacaacag -3'
(R):5'- cttcttctttttcttcttttccttcC -3'

Posted On

2014-05-23