Mutagenetix > Incidental Mutation

Incidental Mutation 'R1780:Ankrd17'

197440

Institutional Source

Beutler Lab

Gene Symbol

Ankrd17

Ensembl Gene

ENSMUSG00000055204

Gene Name

ankyrin repeat domain 17

Synonyms

A130069E23Rik, 4933425K22Rik, Gtar

MMRRC Submission

039811-MU

Accession Numbers

Genbank: NM_030886, NM_198010; MGI: 1932101

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1780 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90227166-90366577 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 90232415 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 2470 (K2470N)

Ref Sequence

ENSEMBL: ENSMUSP00000128960 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014421] [ENSMUST00000081914] [ENSMUST00000168058] [ENSMUST00000197021]

AlphaFold

Q99NH0

Predicted Effect

probably damaging
Transcript: ENSMUST00000014421
AA Change: K2471N

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000014421
Gene: ENSMUSG00000055204
AA Change: K2471N

Domain	Start	End	E-Value	Type
low complexity region	6	40	N/A	INTRINSIC
low complexity region	55	71	N/A	INTRINSIC
low complexity region	82	130	N/A	INTRINSIC
ANK	229	258	8.62e1	SMART
ANK	262	291	3.31e-1	SMART
ANK	296	325	3.51e-5	SMART
ANK	329	358	1.33e-5	SMART
ANK	362	391	3.46e-4	SMART
ANK	396	425	3.23e-4	SMART
ANK	429	458	1.61e-4	SMART
ANK	462	491	1.46e-2	SMART
ANK	495	524	3.88e-7	SMART
ANK	529	558	4.19e-3	SMART
ANK	559	588	1.76e-5	SMART
ANK	592	621	3.51e-5	SMART
ANK	625	654	5.62e-4	SMART
ANK	659	688	1.29e-3	SMART
ANK	692	721	1.44e-1	SMART
coiled coil region	800	883	N/A	INTRINSIC
low complexity region	890	903	N/A	INTRINSIC
low complexity region	955	968	N/A	INTRINSIC
low complexity region	986	997	N/A	INTRINSIC
low complexity region	1046	1060	N/A	INTRINSIC
ANK	1078	1107	2.13e-4	SMART
ANK	1111	1140	8.19e-6	SMART
ANK	1145	1174	1.68e-2	SMART
ANK	1178	1207	1.61e-4	SMART
ANK	1213	1242	1.43e-5	SMART
ANK	1247	1276	1.83e-3	SMART
ANK	1280	1309	3.91e-3	SMART
ANK	1315	1344	1.93e-2	SMART
ANK	1348	1377	8.78e-6	SMART
ANK	1381	1410	7.59e-1	SMART
coiled coil region	1454	1522	N/A	INTRINSIC
low complexity region	1597	1611	N/A	INTRINSIC
low complexity region	1616	1636	N/A	INTRINSIC
KH	1720	1790	8.31e-14	SMART
low complexity region	1816	1827	N/A	INTRINSIC
low complexity region	1834	1850	N/A	INTRINSIC
low complexity region	1946	1989	N/A	INTRINSIC
low complexity region	1996	2024	N/A	INTRINSIC
low complexity region	2035	2052	N/A	INTRINSIC
low complexity region	2068	2077	N/A	INTRINSIC
low complexity region	2086	2110	N/A	INTRINSIC
low complexity region	2175	2189	N/A	INTRINSIC
low complexity region	2348	2365	N/A	INTRINSIC
low complexity region	2392	2411	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081914
AA Change: K2220N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000080587
Gene: ENSMUSG00000055204
AA Change: K2220N

Domain	Start	End	E-Value	Type
low complexity region	6	40	N/A	INTRINSIC
low complexity region	55	71	N/A	INTRINSIC
low complexity region	82	130	N/A	INTRINSIC
ANK	229	258	8.62e1	SMART
ANK	262	291	3.31e-1	SMART
ANK	296	325	3.51e-5	SMART
ANK	329	358	1.33e-5	SMART
ANK	362	391	3.46e-4	SMART
ANK	396	425	3.23e-4	SMART
ANK	429	458	1.61e-4	SMART
ANK	462	491	1.46e-2	SMART
ANK	495	524	3.88e-7	SMART
ANK	529	558	4.19e-3	SMART
ANK	559	588	1.76e-5	SMART
ANK	592	621	3.51e-5	SMART
ANK	625	654	5.62e-4	SMART
ANK	659	688	1.29e-3	SMART
ANK	692	721	1.44e-1	SMART
low complexity region	795	809	N/A	INTRINSIC
ANK	827	856	2.13e-4	SMART
ANK	860	889	8.19e-6	SMART
ANK	894	923	1.68e-2	SMART
ANK	927	956	1.61e-4	SMART
ANK	962	991	1.43e-5	SMART
ANK	996	1025	1.83e-3	SMART
ANK	1029	1058	3.91e-3	SMART
ANK	1064	1093	1.93e-2	SMART
ANK	1097	1126	8.78e-6	SMART
ANK	1130	1159	7.59e-1	SMART
coiled coil region	1203	1271	N/A	INTRINSIC
low complexity region	1346	1360	N/A	INTRINSIC
low complexity region	1365	1385	N/A	INTRINSIC
KH	1469	1539	8.31e-14	SMART
low complexity region	1565	1576	N/A	INTRINSIC
low complexity region	1583	1599	N/A	INTRINSIC
low complexity region	1695	1738	N/A	INTRINSIC
low complexity region	1745	1773	N/A	INTRINSIC
low complexity region	1784	1801	N/A	INTRINSIC
low complexity region	1817	1826	N/A	INTRINSIC
low complexity region	1835	1859	N/A	INTRINSIC
low complexity region	1924	1938	N/A	INTRINSIC
low complexity region	2097	2114	N/A	INTRINSIC
low complexity region	2141	2160	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168058
AA Change: K2470N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000128960
Gene: ENSMUSG00000055204
AA Change: K2470N

Domain	Start	End	E-Value	Type
low complexity region	6	40	N/A	INTRINSIC
low complexity region	55	71	N/A	INTRINSIC
low complexity region	82	130	N/A	INTRINSIC
ANK	229	258	8.62e1	SMART
ANK	262	291	3.31e-1	SMART
ANK	296	325	3.51e-5	SMART
ANK	329	358	1.33e-5	SMART
ANK	362	391	3.46e-4	SMART
ANK	396	425	3.23e-4	SMART
ANK	429	458	1.61e-4	SMART
ANK	462	491	1.46e-2	SMART
ANK	495	524	3.88e-7	SMART
ANK	529	558	4.19e-3	SMART
ANK	559	588	1.76e-5	SMART
ANK	592	621	3.51e-5	SMART
ANK	625	654	5.62e-4	SMART
ANK	659	688	1.29e-3	SMART
ANK	692	721	1.44e-1	SMART
coiled coil region	800	883	N/A	INTRINSIC
low complexity region	890	903	N/A	INTRINSIC
low complexity region	955	968	N/A	INTRINSIC
low complexity region	986	997	N/A	INTRINSIC
low complexity region	1046	1060	N/A	INTRINSIC
ANK	1078	1107	2.13e-4	SMART
ANK	1111	1140	8.19e-6	SMART
ANK	1145	1174	1.68e-2	SMART
ANK	1178	1207	1.61e-4	SMART
ANK	1213	1242	1.43e-5	SMART
ANK	1247	1276	1.83e-3	SMART
ANK	1280	1309	3.91e-3	SMART
ANK	1315	1344	1.93e-2	SMART
ANK	1348	1377	8.78e-6	SMART
ANK	1381	1410	7.59e-1	SMART
coiled coil region	1454	1522	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196919

Predicted Effect

possibly damaging
Transcript: ENSMUST00000197021
AA Change: K2362N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000142575
Gene: ENSMUSG00000055204
AA Change: K2362N

Domain	Start	End	E-Value	Type
ANK	120	149	5.4e-1	SMART
ANK	153	182	2e-3	SMART
ANK	187	216	2.2e-7	SMART
ANK	220	249	8.2e-8	SMART
ANK	253	282	2.2e-6	SMART
ANK	287	316	2.1e-6	SMART
ANK	320	349	9.9e-7	SMART
ANK	353	382	9.5e-5	SMART
ANK	386	415	2.4e-9	SMART
ANK	420	449	2.6e-5	SMART
ANK	450	479	1.1e-7	SMART
ANK	483	512	2.2e-7	SMART
ANK	516	545	3.5e-6	SMART
ANK	550	579	7.9e-6	SMART
ANK	583	612	8.9e-4	SMART
coiled coil region	691	774	N/A	INTRINSIC
low complexity region	781	794	N/A	INTRINSIC
low complexity region	846	859	N/A	INTRINSIC
low complexity region	877	888	N/A	INTRINSIC
low complexity region	937	951	N/A	INTRINSIC
ANK	969	998	1.4e-6	SMART
ANK	1002	1031	5.3e-8	SMART
ANK	1036	1065	1e-4	SMART
ANK	1069	1098	1e-6	SMART
ANK	1104	1133	9.1e-8	SMART
ANK	1138	1167	1.2e-5	SMART
ANK	1171	1200	2.5e-5	SMART
ANK	1206	1235	1.2e-4	SMART
ANK	1239	1268	5.5e-8	SMART
ANK	1272	1301	4.7e-3	SMART
coiled coil region	1345	1413	N/A	INTRINSIC
low complexity region	1488	1502	N/A	INTRINSIC
low complexity region	1507	1527	N/A	INTRINSIC
KH	1611	1681	5.1e-16	SMART
low complexity region	1707	1718	N/A	INTRINSIC
low complexity region	1725	1741	N/A	INTRINSIC
low complexity region	1837	1880	N/A	INTRINSIC
low complexity region	1887	1915	N/A	INTRINSIC
low complexity region	1926	1943	N/A	INTRINSIC
low complexity region	1959	1968	N/A	INTRINSIC
low complexity region	1977	2001	N/A	INTRINSIC
low complexity region	2066	2080	N/A	INTRINSIC
low complexity region	2239	2256	N/A	INTRINSIC
low complexity region	2283	2302	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197327

Meta Mutation Damage Score

0.0606

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.3%

Validation Efficiency

98% (80/82)

MGI Phenotype

Strain: 4360512
Lethality: E10-E12
FUNCTION: This gene encodes a protein with ankyrin repeats, which are associated with protein-protein interactions. Studies suggest that this protein is involved in liver development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with hemorrhages, impaired vascular smooth muscle cell development, impaired vascular integrity, and growth retardation. [provided by MGI curators]

Allele List at MGI

All alleles(133) : Targeted(4) Gene trapped(129)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,852,593	E493G	probably damaging	Het
Aff3	A	T	1: 38,535,702	S66T	probably damaging	Het
Ap3m1	T	C	14: 21,041,070	T156A	probably benign	Het
Arhgef4	T	A	1: 34,724,160	S832R	possibly damaging	Het
Asb10	T	C	5: 24,533,676	D423G	possibly damaging	Het
Ash1l	A	G	3: 88,965,984	T25A	probably benign	Het
Atp13a2	T	A	4: 141,002,460	L663I	possibly damaging	Het
Atp9b	A	T	18: 80,776,897	Y174*	probably null	Het
Bche	A	G	3: 73,700,620	I491T	probably benign	Het
Bckdhb	T	C	9: 83,953,783		probably null	Het
Cadps2	C	T	6: 23,320,932		probably null	Het
Cdc42bpb	A	T	12: 111,322,907	V468E	probably damaging	Het
Chrnd	T	C	1: 87,192,548	V33A	possibly damaging	Het
Col6a5	A	T	9: 105,936,878	V645D	unknown	Het
Cpa1	C	T	6: 30,643,008	L312F	probably damaging	Het
Cyp2a5	A	G	7: 26,841,876		probably benign	Het
Cyp2c39	C	A	19: 39,538,851		probably benign	Het
Cyp2d26	T	C	15: 82,794,007	N56S	probably damaging	Het
Ddx21	A	G	10: 62,594,147		probably benign	Het
Dnah11	A	T	12: 118,027,558	C2358S	probably damaging	Het
Entpd8	T	C	2: 25,084,306	S368P	probably benign	Het
Epg5	A	T	18: 78,023,990	Q2222L	probably damaging	Het
Ercc5	T	A	1: 44,167,796	V623E	probably benign	Het
Flg2	A	G	3: 93,202,999	E778G	unknown	Het
Gbe1	C	T	16: 70,495,324	R515*	probably null	Het
Hsd17b6	A	G	10: 127,994,327		probably null	Het
Hyal6	C	T	6: 24,734,032		probably benign	Het
Ifi27l2b	A	G	12: 103,451,319	I203T	probably damaging	Het
Kcnk9	A	C	15: 72,512,401	D309E	unknown	Het
Lrp6	C	T	6: 134,464,451	R1184Q	probably damaging	Het
Mdn1	T	C	4: 32,700,103	F1399L	probably damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Mx1	T	C	16: 97,451,512	*289W	probably null	Het
Myo7b	T	C	18: 31,961,185	E1970G	probably damaging	Het
Mypn	T	C	10: 63,121,964	Y24C	probably damaging	Het
Naxe	G	C	3: 88,057,133	P167A	probably benign	Het
Nmnat2	A	T	1: 153,112,440	K272*	probably null	Het
Nmnat3	C	T	9: 98,354,111	T19M	probably damaging	Het
Olfr1275	T	C	2: 111,231,698	I32V	probably benign	Het
Olfr1412	G	A	1: 92,588,389	V20M	probably benign	Het
Olfr1474	A	G	19: 13,471,362	T131A	probably benign	Het
Olfr64	A	T	7: 103,893,555	F60Y	probably damaging	Het
Olfr66	A	G	7: 103,881,592	V217A	probably benign	Het
Pgm3	T	G	9: 86,556,204	E509D	probably damaging	Het
Phf3	A	T	1: 30,811,942	D1110E	probably damaging	Het
Pkd1	T	G	17: 24,581,569	S3062A	probably benign	Het
Pogz	A	T	3: 94,870,126	K372N	possibly damaging	Het
Pou1f1	A	G	16: 65,523,470	Y15C	probably benign	Het
Ppfia2	A	G	10: 106,896,507	T972A	possibly damaging	Het
Rasip1	A	G	7: 45,635,318	Y703C	possibly damaging	Het
Recql	T	A	6: 142,364,598	Q502L	probably benign	Het
Rgs9	A	T	11: 109,239,499	Y383*	probably null	Het
Rimbp3	T	C	16: 17,212,632	S1307P	probably benign	Het
Rspo1	A	G	4: 125,007,745	T200A	probably damaging	Het
Ryr3	C	T	2: 112,867,292	M922I	probably damaging	Het
Samm50	C	T	15: 84,211,127	A438V	probably damaging	Het
Sec1	A	C	7: 45,678,832	S264A	probably benign	Het
Sec31a	A	T	5: 100,381,336		probably null	Het
Slc13a3	T	C	2: 165,406,699	N553S	unknown	Het
Smg6	T	A	11: 74,946,116	L852Q	probably damaging	Het
Spata13	A	G	14: 60,691,725	N244S	probably damaging	Het
Srbd1	T	C	17: 86,057,685	R648G	probably damaging	Het
Sugct	T	G	13: 17,452,454		probably null	Het
Tmed10	A	G	12: 85,354,879	Y85H	probably damaging	Het
Trim68	A	G	7: 102,684,073	I134T	possibly damaging	Het
Trio	A	G	15: 27,744,038	C2603R	possibly damaging	Het
Tspyl3	G	A	2: 153,225,256	R21W	probably damaging	Het
Ttn	T	C	2: 76,810,699	I11863V	probably null	Het
Ubp1	G	A	9: 113,964,579	A283T	possibly damaging	Het
Ubtf	A	T	11: 102,314,918	F60L	probably damaging	Het
Vmn1r235	T	C	17: 21,261,737	I108T	probably benign	Het
Vmn2r125	T	C	4: 156,351,373	S349P	probably damaging	Het
Vmn2r25	A	G	6: 123,828,465	S478P	probably damaging	Het
Vmn2r88	T	A	14: 51,418,572	V746D	probably damaging	Het
Zcwpw1	A	G	5: 137,796,652	K37E	probably damaging	Het
Zdhhc24	T	C	19: 4,883,766	S284P	probably damaging	Het
Zswim8	C	A	14: 20,716,327	H841N	probably damaging	Het

Other mutations in Ankrd17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ankrd17	APN	5	90233928	missense	probably damaging	0.98
IGL00484:Ankrd17	APN	5	90268361	missense	probably damaging	0.99
IGL01320:Ankrd17	APN	5	90260129	missense	probably damaging	0.99
IGL01776:Ankrd17	APN	5	90283364	nonsense	probably null
IGL02093:Ankrd17	APN	5	90242963	missense	possibly damaging	0.93
IGL02292:Ankrd17	APN	5	90252859	unclassified	probably benign
IGL02302:Ankrd17	APN	5	90283198	missense	probably benign	0.23
IGL02472:Ankrd17	APN	5	90264151	missense	probably damaging	1.00
IGL02705:Ankrd17	APN	5	90283115	missense	probably benign	0.15
IGL02727:Ankrd17	APN	5	90244292	missense	possibly damaging	0.93
IGL02884:Ankrd17	APN	5	90264757	missense	probably damaging	1.00
3-1:Ankrd17	UTSW	5	90243154	missense	probably damaging	0.99
PIT1430001:Ankrd17	UTSW	5	90252973	missense	possibly damaging	0.91
R0025:Ankrd17	UTSW	5	90250405	missense	probably damaging	0.99
R0076:Ankrd17	UTSW	5	90244406	nonsense	probably null
R0076:Ankrd17	UTSW	5	90244406	nonsense	probably null
R0271:Ankrd17	UTSW	5	90254799	missense	possibly damaging	0.90
R0684:Ankrd17	UTSW	5	90263998	missense	probably damaging	0.99
R1239:Ankrd17	UTSW	5	90288676	missense	probably damaging	0.99
R1457:Ankrd17	UTSW	5	90285846	missense	possibly damaging	0.92
R1505:Ankrd17	UTSW	5	90300026	missense	possibly damaging	0.53
R1766:Ankrd17	UTSW	5	90264797	missense	possibly damaging	0.95
R1770:Ankrd17	UTSW	5	90243376	missense	possibly damaging	0.84
R1916:Ankrd17	UTSW	5	90260141	missense	probably damaging	1.00
R1926:Ankrd17	UTSW	5	90244169	missense	probably damaging	1.00
R2090:Ankrd17	UTSW	5	90298046	missense	possibly damaging	0.92
R2153:Ankrd17	UTSW	5	90234059	missense	probably damaging	0.98
R2279:Ankrd17	UTSW	5	90264717	missense	probably damaging	1.00
R2420:Ankrd17	UTSW	5	90289320	missense	possibly damaging	0.94
R3012:Ankrd17	UTSW	5	90230868	missense	probably damaging	1.00
R3417:Ankrd17	UTSW	5	90243913	missense	possibly damaging	0.86
R3704:Ankrd17	UTSW	5	90243969	missense	possibly damaging	0.72
R4581:Ankrd17	UTSW	5	90283120	missense	possibly damaging	0.67
R4850:Ankrd17	UTSW	5	90264786	missense	probably damaging	1.00
R4926:Ankrd17	UTSW	5	90300032	missense	probably damaging	1.00
R5023:Ankrd17	UTSW	5	90282868	missense	probably damaging	1.00
R5068:Ankrd17	UTSW	5	90254808	missense	probably damaging	0.96
R5109:Ankrd17	UTSW	5	90243536	missense	possibly damaging	0.83
R5111:Ankrd17	UTSW	5	90242999	missense	possibly damaging	0.85
R5214:Ankrd17	UTSW	5	90283460	missense	possibly damaging	0.48
R5362:Ankrd17	UTSW	5	90265545	missense	probably damaging	1.00
R5576:Ankrd17	UTSW	5	90243224	missense	probably benign	0.00
R5615:Ankrd17	UTSW	5	90283436	missense	possibly damaging	0.88
R5874:Ankrd17	UTSW	5	90268797	intron	probably benign
R5932:Ankrd17	UTSW	5	90265436	missense	probably damaging	1.00
R5944:Ankrd17	UTSW	5	90285843	missense	probably damaging	1.00
R5993:Ankrd17	UTSW	5	90339672	intron	probably benign
R6052:Ankrd17	UTSW	5	90253832	missense	probably benign	0.03
R6088:Ankrd17	UTSW	5	90253688	missense	possibly damaging	0.95
R6306:Ankrd17	UTSW	5	90244154	missense	probably benign	0.03
R6418:Ankrd17	UTSW	5	90278345	missense	possibly damaging	0.89
R6663:Ankrd17	UTSW	5	90264064	missense	probably damaging	1.00
R6758:Ankrd17	UTSW	5	90263313	missense	probably damaging	1.00
R6782:Ankrd17	UTSW	5	90254738	missense	possibly damaging	0.91
R6793:Ankrd17	UTSW	5	90265512	missense	probably damaging	1.00
R6929:Ankrd17	UTSW	5	90285525	missense	possibly damaging	0.86
R7008:Ankrd17	UTSW	5	90260096	missense	possibly damaging	0.93
R7051:Ankrd17	UTSW	5	90366451	unclassified	probably benign
R7077:Ankrd17	UTSW	5	90285864	missense	possibly damaging	0.92
R7134:Ankrd17	UTSW	5	90232314	missense	probably damaging	0.99
R7134:Ankrd17	UTSW	5	90285523	missense	probably benign	0.03
R7138:Ankrd17	UTSW	5	90242977	missense	probably benign	0.38
R7143:Ankrd17	UTSW	5	90285961	missense	possibly damaging	0.85
R7173:Ankrd17	UTSW	5	90260117	missense	possibly damaging	0.95
R7176:Ankrd17	UTSW	5	90268735	missense	probably damaging	0.99
R7365:Ankrd17	UTSW	5	90291151	missense	possibly damaging	0.45
R7390:Ankrd17	UTSW	5	90282920	missense	probably benign	0.13
R7430:Ankrd17	UTSW	5	90295657	missense	possibly damaging	0.80
R7468:Ankrd17	UTSW	5	90243043	missense	probably benign
R7483:Ankrd17	UTSW	5	90299996	missense	probably benign	0.00
R7492:Ankrd17	UTSW	5	90233948	missense	possibly damaging	0.85
R7610:Ankrd17	UTSW	5	90232363	missense	possibly damaging	0.93
R7636:Ankrd17	UTSW	5	90232380	missense	possibly damaging	0.53
R7790:Ankrd17	UTSW	5	90260152	missense	possibly damaging	0.61
R7839:Ankrd17	UTSW	5	90263354	missense	probably damaging	0.97
R7853:Ankrd17	UTSW	5	90238966	missense	possibly damaging	0.91
R7976:Ankrd17	UTSW	5	90283592	nonsense	probably null
R8054:Ankrd17	UTSW	5	90291055	missense	probably benign	0.43
R8230:Ankrd17	UTSW	5	90243976	missense	possibly damaging	0.86
R8274:Ankrd17	UTSW	5	90282859	missense	probably benign	0.15
R8365:Ankrd17	UTSW	5	90250519	missense	possibly damaging	0.95
R8532:Ankrd17	UTSW	5	90264820	missense	probably damaging	1.00
R8729:Ankrd17	UTSW	5	90295593	missense	probably benign
R8812:Ankrd17	UTSW	5	90293203	missense	probably benign	0.09
R8933:Ankrd17	UTSW	5	90258466	missense	probably damaging	0.99
R9051:Ankrd17	UTSW	5	90263275	missense	probably damaging	0.99
R9055:Ankrd17	UTSW	5	90232309	missense	probably benign	0.33
R9136:Ankrd17	UTSW	5	90244419	missense	probably damaging	0.96
R9158:Ankrd17	UTSW	5	90268716	missense	probably damaging	1.00
R9201:Ankrd17	UTSW	5	90230939	missense	possibly damaging	0.84
R9315:Ankrd17	UTSW	5	90250501	missense	probably damaging	0.97
R9364:Ankrd17	UTSW	5	90268649	missense	probably damaging	1.00
R9366:Ankrd17	UTSW	5	90268649	missense	probably damaging	1.00
R9368:Ankrd17	UTSW	5	90244127	missense	possibly damaging	0.91
R9368:Ankrd17	UTSW	5	90268649	missense	probably damaging	1.00
R9369:Ankrd17	UTSW	5	90268649	missense	probably damaging	1.00
R9381:Ankrd17	UTSW	5	90268649	missense	probably damaging	1.00
R9570:Ankrd17	UTSW	5	90253677	missense
X0019:Ankrd17	UTSW	5	90298654	missense	probably damaging	1.00
Z1177:Ankrd17	UTSW	5	90283505	missense	possibly damaging	0.83
Z1177:Ankrd17	UTSW	5	90289325	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- GCCAGTCTGACCTGCCAAGC -3'
(R):5'- TTCTTCCCACACTTAGAGTGAGAAAAGC -3'

Sequencing Primer
(F):5'- CACAGCTTATGCACTTGGAAATG -3'
(R):5'- CACTAAGCAACATGGATATACTGCTG -3'

Posted On

2014-05-23