Mutagenetix > Incidental Mutation

Incidental Mutation 'R1780:Sec31a'

197441

Institutional Source

Beutler Lab

Gene Symbol

Sec31a

Ensembl Gene

ENSMUSG00000035325

Gene Name

Sec31 homolog A (S. cerevisiae)

Synonyms

Sec31l1, 1810024J13Rik

MMRRC Submission

039811-MU

Accession Numbers

Genbank: NM_026969; MGI: 1916412; Ensembl: ENSMUST00000046296, ENSMUST00000094578, ENSMUST00000112918

Essential gene?

Probably essential (E-score: 0.845) question?

Stock #

R1780 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100361649-100416234 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 100381336 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886] [ENSMUST00000183247]

AlphaFold

Q3UPL0

Predicted Effect

probably null
Transcript: ENSMUST00000094578

SMART Domains

Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325

Domain	Start	End	E-Value	Type
WD40	56	102	1.59e1	SMART
WD40	111	151	5.15e-2	SMART
WD40	158	197	5.16e-1	SMART
WD40	200	245	6.63e0	SMART
WD40	249	289	1.95e-2	SMART
WD40	292	332	4.24e-3	SMART
low complexity region	363	373	N/A	INTRINSIC
Pfam:Sec16_C	572	769	3.5e-7	PFAM
low complexity region	866	882	N/A	INTRINSIC
low complexity region	930	949	N/A	INTRINSIC
low complexity region	953	975	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182002

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182569

Predicted Effect

probably null
Transcript: ENSMUST00000182812

Predicted Effect

probably null
Transcript: ENSMUST00000182886

SMART Domains

Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325

Domain	Start	End	E-Value	Type
WD40	56	102	1e-1	SMART
WD40	111	151	3.3e-4	SMART
WD40	158	197	3.2e-3	SMART
WD40	200	245	4.1e-2	SMART
WD40	249	289	1.2e-4	SMART
WD40	292	332	2.6e-5	SMART
low complexity region	363	373	N/A	INTRINSIC
Pfam:Sec16_C	532	731	2.1e-6	PFAM
low complexity region	827	843	N/A	INTRINSIC
low complexity region	891	910	N/A	INTRINSIC
low complexity region	914	936	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000182988

Predicted Effect

probably benign
Transcript: ENSMUST00000183247

SMART Domains

Protein: ENSMUSP00000138129
Gene: ENSMUSG00000035325

Domain	Start	End	E-Value	Type
Pfam:Sec16_C	141	248	1.5e-7	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.3%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,852,593	E493G	probably damaging	Het
Aff3	A	T	1: 38,535,702	S66T	probably damaging	Het
Ankrd17	T	A	5: 90,232,415	K2470N	probably damaging	Het
Ap3m1	T	C	14: 21,041,070	T156A	probably benign	Het
Arhgef4	T	A	1: 34,724,160	S832R	possibly damaging	Het
Asb10	T	C	5: 24,533,676	D423G	possibly damaging	Het
Ash1l	A	G	3: 88,965,984	T25A	probably benign	Het
Atp13a2	T	A	4: 141,002,460	L663I	possibly damaging	Het
Atp9b	A	T	18: 80,776,897	Y174*	probably null	Het
Bche	A	G	3: 73,700,620	I491T	probably benign	Het
Bckdhb	T	C	9: 83,953,783		probably null	Het
Cadps2	C	T	6: 23,320,932		probably null	Het
Cdc42bpb	A	T	12: 111,322,907	V468E	probably damaging	Het
Chrnd	T	C	1: 87,192,548	V33A	possibly damaging	Het
Col6a5	A	T	9: 105,936,878	V645D	unknown	Het
Cpa1	C	T	6: 30,643,008	L312F	probably damaging	Het
Cyp2a5	A	G	7: 26,841,876		probably benign	Het
Cyp2c39	C	A	19: 39,538,851		probably benign	Het
Cyp2d26	T	C	15: 82,794,007	N56S	probably damaging	Het
Ddx21	A	G	10: 62,594,147		probably benign	Het
Dnah11	A	T	12: 118,027,558	C2358S	probably damaging	Het
Entpd8	T	C	2: 25,084,306	S368P	probably benign	Het
Epg5	A	T	18: 78,023,990	Q2222L	probably damaging	Het
Ercc5	T	A	1: 44,167,796	V623E	probably benign	Het
Flg2	A	G	3: 93,202,999	E778G	unknown	Het
Gbe1	C	T	16: 70,495,324	R515*	probably null	Het
Hsd17b6	A	G	10: 127,994,327		probably null	Het
Hyal6	C	T	6: 24,734,032		probably benign	Het
Ifi27l2b	A	G	12: 103,451,319	I203T	probably damaging	Het
Kcnk9	A	C	15: 72,512,401	D309E	unknown	Het
Lrp6	C	T	6: 134,464,451	R1184Q	probably damaging	Het
Mdn1	T	C	4: 32,700,103	F1399L	probably damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Mx1	T	C	16: 97,451,512	*289W	probably null	Het
Myo7b	T	C	18: 31,961,185	E1970G	probably damaging	Het
Mypn	T	C	10: 63,121,964	Y24C	probably damaging	Het
Naxe	G	C	3: 88,057,133	P167A	probably benign	Het
Nmnat2	A	T	1: 153,112,440	K272*	probably null	Het
Nmnat3	C	T	9: 98,354,111	T19M	probably damaging	Het
Olfr1275	T	C	2: 111,231,698	I32V	probably benign	Het
Olfr1412	G	A	1: 92,588,389	V20M	probably benign	Het
Olfr1474	A	G	19: 13,471,362	T131A	probably benign	Het
Olfr64	A	T	7: 103,893,555	F60Y	probably damaging	Het
Olfr66	A	G	7: 103,881,592	V217A	probably benign	Het
Pgm3	T	G	9: 86,556,204	E509D	probably damaging	Het
Phf3	A	T	1: 30,811,942	D1110E	probably damaging	Het
Pkd1	T	G	17: 24,581,569	S3062A	probably benign	Het
Pogz	A	T	3: 94,870,126	K372N	possibly damaging	Het
Pou1f1	A	G	16: 65,523,470	Y15C	probably benign	Het
Ppfia2	A	G	10: 106,896,507	T972A	possibly damaging	Het
Rasip1	A	G	7: 45,635,318	Y703C	possibly damaging	Het
Recql	T	A	6: 142,364,598	Q502L	probably benign	Het
Rgs9	A	T	11: 109,239,499	Y383*	probably null	Het
Rimbp3	T	C	16: 17,212,632	S1307P	probably benign	Het
Rspo1	A	G	4: 125,007,745	T200A	probably damaging	Het
Ryr3	C	T	2: 112,867,292	M922I	probably damaging	Het
Samm50	C	T	15: 84,211,127	A438V	probably damaging	Het
Sec1	A	C	7: 45,678,832	S264A	probably benign	Het
Slc13a3	T	C	2: 165,406,699	N553S	unknown	Het
Smg6	T	A	11: 74,946,116	L852Q	probably damaging	Het
Spata13	A	G	14: 60,691,725	N244S	probably damaging	Het
Srbd1	T	C	17: 86,057,685	R648G	probably damaging	Het
Sugct	T	G	13: 17,452,454		probably null	Het
Tmed10	A	G	12: 85,354,879	Y85H	probably damaging	Het
Trim68	A	G	7: 102,684,073	I134T	possibly damaging	Het
Trio	A	G	15: 27,744,038	C2603R	possibly damaging	Het
Tspyl3	G	A	2: 153,225,256	R21W	probably damaging	Het
Ttn	T	C	2: 76,810,699	I11863V	probably null	Het
Ubp1	G	A	9: 113,964,579	A283T	possibly damaging	Het
Ubtf	A	T	11: 102,314,918	F60L	probably damaging	Het
Vmn1r235	T	C	17: 21,261,737	I108T	probably benign	Het
Vmn2r125	T	C	4: 156,351,373	S349P	probably damaging	Het
Vmn2r25	A	G	6: 123,828,465	S478P	probably damaging	Het
Vmn2r88	T	A	14: 51,418,572	V746D	probably damaging	Het
Zcwpw1	A	G	5: 137,796,652	K37E	probably damaging	Het
Zdhhc24	T	C	19: 4,883,766	S284P	probably damaging	Het
Zswim8	C	A	14: 20,716,327	H841N	probably damaging	Het

Other mutations in Sec31a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00657:Sec31a	APN	5	100404017	nonsense	probably null
IGL01610:Sec31a	APN	5	100402358	splice site	probably benign
IGL01804:Sec31a	APN	5	100375206	critical splice donor site	probably null
IGL02026:Sec31a	APN	5	100369626	missense	probably benign	0.04
IGL02150:Sec31a	APN	5	100386125	splice site	probably benign
IGL02237:Sec31a	APN	5	100362055	missense	probably damaging	1.00
IGL02469:Sec31a	APN	5	100385255	missense	probably benign	0.02
IGL02512:Sec31a	APN	5	100407193	missense	probably damaging	0.99
control	UTSW	5	100362173	missense	probably damaging	1.00
D3080:Sec31a	UTSW	5	100363832	missense	probably damaging	1.00
PIT4142001:Sec31a	UTSW	5	100407275	missense	probably damaging	1.00
R0366:Sec31a	UTSW	5	100382766	missense	probably damaging	1.00
R0453:Sec31a	UTSW	5	100404118	splice site	probably benign
R0511:Sec31a	UTSW	5	100375240	missense	probably benign	0.01
R0546:Sec31a	UTSW	5	100404070	missense	probably damaging	1.00
R0675:Sec31a	UTSW	5	100393207	missense	probably damaging	0.97
R0678:Sec31a	UTSW	5	100407225	missense	possibly damaging	0.74
R0975:Sec31a	UTSW	5	100395904	splice site	probably null
R1146:Sec31a	UTSW	5	100362173	missense	probably damaging	1.00
R1146:Sec31a	UTSW	5	100362173	missense	probably damaging	1.00
R1540:Sec31a	UTSW	5	100375319	missense	probably damaging	1.00
R1616:Sec31a	UTSW	5	100386195	missense	possibly damaging	0.88
R2472:Sec31a	UTSW	5	100385205	missense	probably damaging	1.00
R3689:Sec31a	UTSW	5	100382907	missense	probably damaging	1.00
R4515:Sec31a	UTSW	5	100365958	missense	probably damaging	0.99
R4801:Sec31a	UTSW	5	100393363	missense	probably damaging	0.96
R4802:Sec31a	UTSW	5	100393363	missense	probably damaging	0.96
R4896:Sec31a	UTSW	5	100368333	missense	probably damaging	1.00
R5004:Sec31a	UTSW	5	100368333	missense	probably damaging	1.00
R5053:Sec31a	UTSW	5	100393214	missense	possibly damaging	0.94
R5158:Sec31a	UTSW	5	100393321	missense	probably damaging	0.99
R5191:Sec31a	UTSW	5	100405511	missense	possibly damaging	0.75
R5222:Sec31a	UTSW	5	100382895	missense	probably benign
R5405:Sec31a	UTSW	5	100383798	nonsense	probably null
R5436:Sec31a	UTSW	5	100363839	missense	probably damaging	0.98
R5577:Sec31a	UTSW	5	100402274	missense	possibly damaging	0.95
R6005:Sec31a	UTSW	5	100363878	missense	probably damaging	1.00
R6184:Sec31a	UTSW	5	100369594	critical splice donor site	probably null
R6245:Sec31a	UTSW	5	100386184	missense	probably benign	0.07
R6475:Sec31a	UTSW	5	100385270	missense	probably damaging	1.00
R6476:Sec31a	UTSW	5	100386149	missense	probably benign	0.03
R6744:Sec31a	UTSW	5	100392499	missense	possibly damaging	0.47
R6804:Sec31a	UTSW	5	100382812	missense	probably benign	0.03
R6911:Sec31a	UTSW	5	100393264	missense	possibly damaging	0.92
R6936:Sec31a	UTSW	5	100392510	missense	probably benign
R7345:Sec31a	UTSW	5	100385270	missense	probably damaging	1.00
R7760:Sec31a	UTSW	5	100392628	missense	probably damaging	1.00
R7898:Sec31a	UTSW	5	100399477	missense	probably damaging	0.99
R8088:Sec31a	UTSW	5	100378862	missense
R8555:Sec31a	UTSW	5	100392414	missense	probably benign	0.25
R8762:Sec31a	UTSW	5	100378829	missense
R9055:Sec31a	UTSW	5	100386181	missense	possibly damaging	0.75
R9173:Sec31a	UTSW	5	100381288	missense	possibly damaging	0.85
R9249:Sec31a	UTSW	5	100385224	missense	probably damaging	0.98
X0003:Sec31a	UTSW	5	100399354	missense	probably damaging	0.98
Z1177:Sec31a	UTSW	5	100383845	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTGGTGTTGTCAGGCAGAAAAGC -3'
(R):5'- TGCAGGAAACATGCCATGCACG -3'

Sequencing Primer
(F):5'- tcaggcagaaaagccaagg -3'
(R):5'- AGATCATTGGACAAGTGTCTGGC -3'

Posted On

2014-05-23