Incidental Mutation 'R1780:Samm50'
ID 197482
Institutional Source Beutler Lab
Gene Symbol Samm50
Ensembl Gene ENSMUSG00000022437
Gene Name SAMM50 sorting and assembly machinery component
Synonyms 1110030L07Rik
MMRRC Submission 039811-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock # R1780 (G1)
Quality Score 201
Status Validated
Chromosome 15
Chromosomal Location 84192241-84217267 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84211127 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 438 (A438V)
Ref Sequence ENSEMBL: ENSMUSP00000023071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023071]
AlphaFold Q8BGH2
Predicted Effect probably damaging
Transcript: ENSMUST00000023071
AA Change: A438V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023071
Gene: ENSMUSG00000022437
AA Change: A438V

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:Bac_surface_Ag 151 468 1.8e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230659
Meta Mutation Damage Score 0.6300 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,852,593 E493G probably damaging Het
Aff3 A T 1: 38,535,702 S66T probably damaging Het
Ankrd17 T A 5: 90,232,415 K2470N probably damaging Het
Ap3m1 T C 14: 21,041,070 T156A probably benign Het
Arhgef4 T A 1: 34,724,160 S832R possibly damaging Het
Asb10 T C 5: 24,533,676 D423G possibly damaging Het
Ash1l A G 3: 88,965,984 T25A probably benign Het
Atp13a2 T A 4: 141,002,460 L663I possibly damaging Het
Atp9b A T 18: 80,776,897 Y174* probably null Het
Bche A G 3: 73,700,620 I491T probably benign Het
Bckdhb T C 9: 83,953,783 probably null Het
Cadps2 C T 6: 23,320,932 probably null Het
Cdc42bpb A T 12: 111,322,907 V468E probably damaging Het
Chrnd T C 1: 87,192,548 V33A possibly damaging Het
Col6a5 A T 9: 105,936,878 V645D unknown Het
Cpa1 C T 6: 30,643,008 L312F probably damaging Het
Cyp2a5 A G 7: 26,841,876 probably benign Het
Cyp2c39 C A 19: 39,538,851 probably benign Het
Cyp2d26 T C 15: 82,794,007 N56S probably damaging Het
Ddx21 A G 10: 62,594,147 probably benign Het
Dnah11 A T 12: 118,027,558 C2358S probably damaging Het
Entpd8 T C 2: 25,084,306 S368P probably benign Het
Epg5 A T 18: 78,023,990 Q2222L probably damaging Het
Ercc5 T A 1: 44,167,796 V623E probably benign Het
Flg2 A G 3: 93,202,999 E778G unknown Het
Gbe1 C T 16: 70,495,324 R515* probably null Het
Hsd17b6 A G 10: 127,994,327 probably null Het
Hyal6 C T 6: 24,734,032 probably benign Het
Ifi27l2b A G 12: 103,451,319 I203T probably damaging Het
Kcnk9 A C 15: 72,512,401 D309E unknown Het
Lrp6 C T 6: 134,464,451 R1184Q probably damaging Het
Mdn1 T C 4: 32,700,103 F1399L probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mx1 T C 16: 97,451,512 *289W probably null Het
Myo7b T C 18: 31,961,185 E1970G probably damaging Het
Mypn T C 10: 63,121,964 Y24C probably damaging Het
Naxe G C 3: 88,057,133 P167A probably benign Het
Nmnat2 A T 1: 153,112,440 K272* probably null Het
Nmnat3 C T 9: 98,354,111 T19M probably damaging Het
Olfr1275 T C 2: 111,231,698 I32V probably benign Het
Olfr1412 G A 1: 92,588,389 V20M probably benign Het
Olfr1474 A G 19: 13,471,362 T131A probably benign Het
Olfr64 A T 7: 103,893,555 F60Y probably damaging Het
Olfr66 A G 7: 103,881,592 V217A probably benign Het
Pgm3 T G 9: 86,556,204 E509D probably damaging Het
Phf3 A T 1: 30,811,942 D1110E probably damaging Het
Pkd1 T G 17: 24,581,569 S3062A probably benign Het
Pogz A T 3: 94,870,126 K372N possibly damaging Het
Pou1f1 A G 16: 65,523,470 Y15C probably benign Het
Ppfia2 A G 10: 106,896,507 T972A possibly damaging Het
Rasip1 A G 7: 45,635,318 Y703C possibly damaging Het
Recql T A 6: 142,364,598 Q502L probably benign Het
Rgs9 A T 11: 109,239,499 Y383* probably null Het
Rimbp3 T C 16: 17,212,632 S1307P probably benign Het
Rspo1 A G 4: 125,007,745 T200A probably damaging Het
Ryr3 C T 2: 112,867,292 M922I probably damaging Het
Sec1 A C 7: 45,678,832 S264A probably benign Het
Sec31a A T 5: 100,381,336 probably null Het
Slc13a3 T C 2: 165,406,699 N553S unknown Het
Smg6 T A 11: 74,946,116 L852Q probably damaging Het
Spata13 A G 14: 60,691,725 N244S probably damaging Het
Srbd1 T C 17: 86,057,685 R648G probably damaging Het
Sugct T G 13: 17,452,454 probably null Het
Tmed10 A G 12: 85,354,879 Y85H probably damaging Het
Trim68 A G 7: 102,684,073 I134T possibly damaging Het
Trio A G 15: 27,744,038 C2603R possibly damaging Het
Tspyl3 G A 2: 153,225,256 R21W probably damaging Het
Ttn T C 2: 76,810,699 I11863V probably null Het
Ubp1 G A 9: 113,964,579 A283T possibly damaging Het
Ubtf A T 11: 102,314,918 F60L probably damaging Het
Vmn1r235 T C 17: 21,261,737 I108T probably benign Het
Vmn2r125 T C 4: 156,351,373 S349P probably damaging Het
Vmn2r25 A G 6: 123,828,465 S478P probably damaging Het
Vmn2r88 T A 14: 51,418,572 V746D probably damaging Het
Zcwpw1 A G 5: 137,796,652 K37E probably damaging Het
Zdhhc24 T C 19: 4,883,766 S284P probably damaging Het
Zswim8 C A 14: 20,716,327 H841N probably damaging Het
Other mutations in Samm50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Samm50 APN 15 84200375 missense possibly damaging 0.82
IGL01061:Samm50 APN 15 84202254 missense probably benign 0.00
IGL01549:Samm50 APN 15 84202781 missense probably benign
IGL01586:Samm50 APN 15 84195838 missense probably benign 0.03
IGL02494:Samm50 APN 15 84195814 missense probably benign
IGL02607:Samm50 APN 15 84207838 missense probably benign 0.09
IGL03244:Samm50 APN 15 84214140 missense probably benign 0.09
IGL03340:Samm50 APN 15 84198663 critical splice donor site probably null
R0591:Samm50 UTSW 15 84211168 missense probably benign
R0634:Samm50 UTSW 15 84214171 synonymous silent
R2192:Samm50 UTSW 15 84200424 critical splice donor site probably null
R2205:Samm50 UTSW 15 84202314 missense probably benign 0.01
R3800:Samm50 UTSW 15 84192374 missense probably damaging 0.99
R4285:Samm50 UTSW 15 84197012 missense probably damaging 1.00
R4333:Samm50 UTSW 15 84202830 missense probably benign 0.02
R4780:Samm50 UTSW 15 84210610 missense possibly damaging 0.88
R5223:Samm50 UTSW 15 84200630 missense probably benign 0.07
R5639:Samm50 UTSW 15 84214128 missense probably benign 0.22
R6258:Samm50 UTSW 15 84200311 missense probably damaging 1.00
R6258:Samm50 UTSW 15 84200312 missense probably damaging 0.98
R6437:Samm50 UTSW 15 84204097 critical splice donor site probably null
R6452:Samm50 UTSW 15 84204097 critical splice donor site probably benign
R6715:Samm50 UTSW 15 84211058 missense probably benign
R6957:Samm50 UTSW 15 84198649 missense probably damaging 1.00
R7409:Samm50 UTSW 15 84197030 missense probably benign 0.32
R7459:Samm50 UTSW 15 84195856 critical splice donor site probably null
R7706:Samm50 UTSW 15 84200880 splice site probably null
R7910:Samm50 UTSW 15 84214145 missense possibly damaging 0.49
R8421:Samm50 UTSW 15 84210585 missense probably benign 0.04
R8443:Samm50 UTSW 15 84210501 missense possibly damaging 0.82
R9339:Samm50 UTSW 15 84211075 missense probably benign 0.00
R9457:Samm50 UTSW 15 84207841 missense probably damaging 1.00
X0067:Samm50 UTSW 15 84202833 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCATCCCTTACAATGCCGTTATG -3'
(R):5'- TCCAGCAAGCAGGGTCAACACTTC -3'

Sequencing Primer
(F):5'- TGCGGCTTACTCTAGAAACAAG -3'
(R):5'- AGGGTCAACACTTCCCCTG -3'
Posted On 2014-05-23