Incidental Mutation 'R1780:Epg5'
ID 197492
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Name ectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms
MMRRC Submission 039811-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.910) question?
Stock # R1780 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 77938467-78035027 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78023990 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 2222 (Q2222L)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
AlphaFold Q80TA9
Predicted Effect probably damaging
Transcript: ENSMUST00000044622
AA Change: Q2222L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: Q2222L

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Meta Mutation Damage Score 0.4961 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,852,593 E493G probably damaging Het
Aff3 A T 1: 38,535,702 S66T probably damaging Het
Ankrd17 T A 5: 90,232,415 K2470N probably damaging Het
Ap3m1 T C 14: 21,041,070 T156A probably benign Het
Arhgef4 T A 1: 34,724,160 S832R possibly damaging Het
Asb10 T C 5: 24,533,676 D423G possibly damaging Het
Ash1l A G 3: 88,965,984 T25A probably benign Het
Atp13a2 T A 4: 141,002,460 L663I possibly damaging Het
Atp9b A T 18: 80,776,897 Y174* probably null Het
Bche A G 3: 73,700,620 I491T probably benign Het
Bckdhb T C 9: 83,953,783 probably null Het
Cadps2 C T 6: 23,320,932 probably null Het
Cdc42bpb A T 12: 111,322,907 V468E probably damaging Het
Chrnd T C 1: 87,192,548 V33A possibly damaging Het
Col6a5 A T 9: 105,936,878 V645D unknown Het
Cpa1 C T 6: 30,643,008 L312F probably damaging Het
Cyp2a5 A G 7: 26,841,876 probably benign Het
Cyp2c39 C A 19: 39,538,851 probably benign Het
Cyp2d26 T C 15: 82,794,007 N56S probably damaging Het
Ddx21 A G 10: 62,594,147 probably benign Het
Dnah11 A T 12: 118,027,558 C2358S probably damaging Het
Entpd8 T C 2: 25,084,306 S368P probably benign Het
Ercc5 T A 1: 44,167,796 V623E probably benign Het
Flg2 A G 3: 93,202,999 E778G unknown Het
Gbe1 C T 16: 70,495,324 R515* probably null Het
Hsd17b6 A G 10: 127,994,327 probably null Het
Hyal6 C T 6: 24,734,032 probably benign Het
Ifi27l2b A G 12: 103,451,319 I203T probably damaging Het
Kcnk9 A C 15: 72,512,401 D309E unknown Het
Lrp6 C T 6: 134,464,451 R1184Q probably damaging Het
Mdn1 T C 4: 32,700,103 F1399L probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mx1 T C 16: 97,451,512 *289W probably null Het
Myo7b T C 18: 31,961,185 E1970G probably damaging Het
Mypn T C 10: 63,121,964 Y24C probably damaging Het
Naxe G C 3: 88,057,133 P167A probably benign Het
Nmnat2 A T 1: 153,112,440 K272* probably null Het
Nmnat3 C T 9: 98,354,111 T19M probably damaging Het
Olfr1275 T C 2: 111,231,698 I32V probably benign Het
Olfr1412 G A 1: 92,588,389 V20M probably benign Het
Olfr1474 A G 19: 13,471,362 T131A probably benign Het
Olfr64 A T 7: 103,893,555 F60Y probably damaging Het
Olfr66 A G 7: 103,881,592 V217A probably benign Het
Pgm3 T G 9: 86,556,204 E509D probably damaging Het
Phf3 A T 1: 30,811,942 D1110E probably damaging Het
Pkd1 T G 17: 24,581,569 S3062A probably benign Het
Pogz A T 3: 94,870,126 K372N possibly damaging Het
Pou1f1 A G 16: 65,523,470 Y15C probably benign Het
Ppfia2 A G 10: 106,896,507 T972A possibly damaging Het
Rasip1 A G 7: 45,635,318 Y703C possibly damaging Het
Recql T A 6: 142,364,598 Q502L probably benign Het
Rgs9 A T 11: 109,239,499 Y383* probably null Het
Rimbp3 T C 16: 17,212,632 S1307P probably benign Het
Rspo1 A G 4: 125,007,745 T200A probably damaging Het
Ryr3 C T 2: 112,867,292 M922I probably damaging Het
Samm50 C T 15: 84,211,127 A438V probably damaging Het
Sec1 A C 7: 45,678,832 S264A probably benign Het
Sec31a A T 5: 100,381,336 probably null Het
Slc13a3 T C 2: 165,406,699 N553S unknown Het
Smg6 T A 11: 74,946,116 L852Q probably damaging Het
Spata13 A G 14: 60,691,725 N244S probably damaging Het
Srbd1 T C 17: 86,057,685 R648G probably damaging Het
Sugct T G 13: 17,452,454 probably null Het
Tmed10 A G 12: 85,354,879 Y85H probably damaging Het
Trim68 A G 7: 102,684,073 I134T possibly damaging Het
Trio A G 15: 27,744,038 C2603R possibly damaging Het
Tspyl3 G A 2: 153,225,256 R21W probably damaging Het
Ttn T C 2: 76,810,699 I11863V probably null Het
Ubp1 G A 9: 113,964,579 A283T possibly damaging Het
Ubtf A T 11: 102,314,918 F60L probably damaging Het
Vmn1r235 T C 17: 21,261,737 I108T probably benign Het
Vmn2r125 T C 4: 156,351,373 S349P probably damaging Het
Vmn2r25 A G 6: 123,828,465 S478P probably damaging Het
Vmn2r88 T A 14: 51,418,572 V746D probably damaging Het
Zcwpw1 A G 5: 137,796,652 K37E probably damaging Het
Zdhhc24 T C 19: 4,883,766 S284P probably damaging Het
Zswim8 C A 14: 20,716,327 H841N probably damaging Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78012741 missense probably damaging 1.00
IGL01778:Epg5 APN 18 78019274 missense probably damaging 0.98
IGL01936:Epg5 APN 18 77985101 missense probably damaging 1.00
IGL02189:Epg5 APN 18 78012870 missense probably damaging 0.99
IGL02323:Epg5 APN 18 78012832 nonsense probably null
IGL02567:Epg5 APN 18 78033073 missense probably damaging 1.00
IGL02805:Epg5 APN 18 78030191 splice site probably benign
IGL03282:Epg5 APN 18 77986426 missense probably benign 0.25
stitch UTSW 18 77948299 nonsense probably null
R0011:Epg5 UTSW 18 77948483 missense probably benign
R0172:Epg5 UTSW 18 78027359 missense probably benign 0.00
R0335:Epg5 UTSW 18 77986472 missense probably benign 0.25
R0380:Epg5 UTSW 18 77960841 missense probably damaging 1.00
R0441:Epg5 UTSW 18 78023271 splice site probably benign
R0443:Epg5 UTSW 18 77955903 splice site probably benign
R0445:Epg5 UTSW 18 78014184 missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78023365 missense probably damaging 1.00
R0892:Epg5 UTSW 18 77968628 missense possibly damaging 0.94
R1081:Epg5 UTSW 18 77959533 missense possibly damaging 0.92
R1183:Epg5 UTSW 18 77960711 missense probably damaging 1.00
R1374:Epg5 UTSW 18 77981326 missense probably benign
R1428:Epg5 UTSW 18 77962427 missense probably damaging 1.00
R1727:Epg5 UTSW 18 78015815 missense possibly damaging 0.94
R1801:Epg5 UTSW 18 77983490 missense possibly damaging 0.63
R1864:Epg5 UTSW 18 77975031 missense probably damaging 0.99
R1908:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1909:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1916:Epg5 UTSW 18 77965021 missense probably benign 0.00
R1986:Epg5 UTSW 18 77982306 critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78023987 missense probably damaging 0.98
R2080:Epg5 UTSW 18 77948745 missense probably benign 0.01
R2106:Epg5 UTSW 18 77991363 nonsense probably null
R2144:Epg5 UTSW 18 77954197 missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78027302 missense probably benign
R2217:Epg5 UTSW 18 77949072 missense probably benign
R2424:Epg5 UTSW 18 77968613 missense probably benign 0.05
R2909:Epg5 UTSW 18 77983476 missense probably damaging 1.00
R3725:Epg5 UTSW 18 78017679 missense probably benign 0.00
R3899:Epg5 UTSW 18 77957510 missense probably damaging 1.00
R4019:Epg5 UTSW 18 78030450 missense probably damaging 0.98
R4260:Epg5 UTSW 18 77959121 missense possibly damaging 0.50
R4260:Epg5 UTSW 18 78015699 missense probably damaging 1.00
R4448:Epg5 UTSW 18 77962461 missense probably damaging 1.00
R4475:Epg5 UTSW 18 77948508 missense probably benign
R4612:Epg5 UTSW 18 77982414 missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78012864 missense probably benign 0.45
R4767:Epg5 UTSW 18 78023283 missense possibly damaging 0.67
R4779:Epg5 UTSW 18 77991365 missense probably benign 0.01
R4791:Epg5 UTSW 18 77948996 nonsense probably null
R4797:Epg5 UTSW 18 78030399 missense probably benign 0.00
R4812:Epg5 UTSW 18 77979184 missense probably benign 0.01
R4899:Epg5 UTSW 18 77985057 missense probably damaging 1.00
R5000:Epg5 UTSW 18 77954161 missense probably benign
R5031:Epg5 UTSW 18 78028948 missense probably benign 0.00
R5050:Epg5 UTSW 18 77975941 missense possibly damaging 0.55
R5114:Epg5 UTSW 18 77995613 missense probably benign
R5144:Epg5 UTSW 18 78015680 missense probably damaging 1.00
R5209:Epg5 UTSW 18 77951282 missense probably damaging 1.00
R5213:Epg5 UTSW 18 78014834 missense probably benign 0.01
R5270:Epg5 UTSW 18 77983563 missense possibly damaging 0.79
R5324:Epg5 UTSW 18 77962445 missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78027497 missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77951207 missense possibly damaging 0.81
R5593:Epg5 UTSW 18 77957474 missense probably damaging 1.00
R5718:Epg5 UTSW 18 77986403 missense probably damaging 1.00
R5773:Epg5 UTSW 18 77960825 missense probably damaging 1.00
R5828:Epg5 UTSW 18 78020851 missense probably damaging 0.99
R5847:Epg5 UTSW 18 78030055 missense probably benign 0.06
R5858:Epg5 UTSW 18 77948299 nonsense probably null
R5914:Epg5 UTSW 18 77959632 critical splice donor site probably null
R6124:Epg5 UTSW 18 78030045 missense probably benign
R6228:Epg5 UTSW 18 77948462 missense possibly damaging 0.90
R6252:Epg5 UTSW 18 77985167 missense probably damaging 1.00
R6269:Epg5 UTSW 18 77948370 missense probably benign
R6312:Epg5 UTSW 18 77979211 missense possibly damaging 0.72
R6320:Epg5 UTSW 18 77962398 missense probably damaging 1.00
R6328:Epg5 UTSW 18 78028964 missense possibly damaging 0.88
R6430:Epg5 UTSW 18 77975885 missense probably damaging 1.00
R6458:Epg5 UTSW 18 77948254 missense probably benign 0.03
R6852:Epg5 UTSW 18 78012891 missense probably damaging 1.00
R6915:Epg5 UTSW 18 77979165 missense probably benign 0.00
R6930:Epg5 UTSW 18 78014163 missense probably damaging 0.99
R6932:Epg5 UTSW 18 77948609 missense probably benign 0.00
R7127:Epg5 UTSW 18 78028925 missense probably damaging 1.00
R7207:Epg5 UTSW 18 77948955 missense probably damaging 1.00
R7225:Epg5 UTSW 18 78012702 missense probably benign 0.45
R7358:Epg5 UTSW 18 77959037 missense possibly damaging 0.78
R7414:Epg5 UTSW 18 77983532 missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78023278 missense probably benign 0.01
R7535:Epg5 UTSW 18 78032926 missense probably benign 0.18
R7586:Epg5 UTSW 18 78030060 missense probably benign
R7651:Epg5 UTSW 18 77981400 nonsense probably null
R7715:Epg5 UTSW 18 77968586 missense probably damaging 1.00
R7753:Epg5 UTSW 18 77948345 missense possibly damaging 0.92
R7981:Epg5 UTSW 18 78009714 critical splice donor site probably null
R8114:Epg5 UTSW 18 78030150 missense probably benign 0.41
R8124:Epg5 UTSW 18 77964996 missense probably benign 0.05
R8307:Epg5 UTSW 18 78022679 missense probably damaging 1.00
R8458:Epg5 UTSW 18 77948731 missense probably benign 0.00
R8751:Epg5 UTSW 18 77965008 missense probably benign 0.07
R8751:Epg5 UTSW 18 77965009 missense possibly damaging 0.65
R8751:Epg5 UTSW 18 77965010 missense probably benign 0.28
R8888:Epg5 UTSW 18 78012871 missense possibly damaging 0.76
R8971:Epg5 UTSW 18 77979219 missense probably damaging 1.00
R9045:Epg5 UTSW 18 77948799 missense probably damaging 1.00
R9291:Epg5 UTSW 18 78012850 nonsense probably null
R9327:Epg5 UTSW 18 77948220 missense probably benign 0.00
R9365:Epg5 UTSW 18 77954742 missense probably damaging 1.00
R9742:Epg5 UTSW 18 77980955 missense probably damaging 1.00
X0023:Epg5 UTSW 18 77968657 missense probably damaging 0.99
X0060:Epg5 UTSW 18 77962485 missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 77959139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCATGCTGTGGACCTTGGGAATATC -3'
(R):5'- TGTGCATCTGCCAGAGTCAACC -3'

Sequencing Primer
(F):5'- GGACCTTGGGAATATCCAGCTAAC -3'
(R):5'- ACGTCTGGATCACTGCTG -3'
Posted On 2014-05-23