Incidental Mutation 'R1195:Msx1'
ID 197525
Institutional Source Beutler Lab
Gene Symbol Msx1
Ensembl Gene ENSMUSG00000048450
Gene Name msh homeobox 1
Synonyms Hox7.1, Hox7, Hox-7, msh, muscle-segment homeobox
MMRRC Submission 039267-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1195 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 37977835-37981929 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37978625 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 297 (Y297H)
Ref Sequence ENSEMBL: ENSMUSP00000058354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063116]
AlphaFold P13297
PDB Structure Msx-1 Homeodomain/DNA Complex Structure [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000063116
AA Change: Y297H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058354
Gene: ENSMUSG00000048450
AA Change: Y297H

DomainStartEndE-ValueType
low complexity region 22 50 N/A INTRINSIC
low complexity region 148 162 N/A INTRINSIC
HOX 172 234 1.37e-24 SMART
low complexity region 237 250 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183013
Meta Mutation Damage Score 0.5140 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the muscle segment homeobox gene family. The encoded protein functions as a transcriptional repressor during embryogenesis through interactions with components of the core transcription complex and other homeoproteins. It may also have roles in limb-pattern formation, craniofacial development, particularly odontogenesis, and tumor growth inhibition. Mutations in this gene, which was once known as homeobox 7, have been associated with nonsyndromic cleft lip with or without cleft palate 5, Witkop syndrome, Wolf-Hirschom syndrome, and autosomoal dominant hypodontia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants affect craniofacial neural crest-derived mesenchyme by controlling cell cycle progression. Homozygous null mutants die at birth with multiple craniofacial defects including cleft palate, reduced mandible and maxilla, and retarded tooth development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a C A 13: 30,565,901 (GRCm39) P322Q probably damaging Het
Amh AGCGCCTTGG AG 10: 80,641,419 (GRCm39) probably null Het
Brd1 T C 15: 88,585,014 (GRCm39) E940G probably benign Het
Cd163 T A 6: 124,302,209 (GRCm39) probably benign Het
Cd28 C T 1: 60,802,303 (GRCm39) T74I possibly damaging Het
Cntnap2 T A 6: 46,460,902 (GRCm39) M646K probably benign Het
Cyb5d1 C T 11: 69,285,797 (GRCm39) probably null Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dab2ip T C 2: 35,608,757 (GRCm39) probably benign Het
Dnajc25 C T 4: 59,003,415 (GRCm39) A62V probably damaging Het
Dst A G 1: 34,250,235 (GRCm39) D4063G probably damaging Het
Elmod1 T C 9: 53,843,052 (GRCm39) Y42C probably damaging Het
Hdac5 T C 11: 102,096,332 (GRCm39) I310V probably damaging Het
Hpx A G 7: 105,248,856 (GRCm39) probably benign Het
Ighv10-1 A T 12: 114,443,015 (GRCm39) probably benign Het
Igsf3 A G 3: 101,365,419 (GRCm39) D1130G probably benign Het
Katnip A G 7: 125,465,654 (GRCm39) R1343G probably damaging Het
Kdm4d A G 9: 14,374,395 (GRCm39) S488P probably benign Het
Lingo2 A G 4: 35,708,538 (GRCm39) Y481H probably damaging Het
Ltbp1 A G 17: 75,532,280 (GRCm39) Q118R possibly damaging Het
Map3k20 C T 2: 72,268,562 (GRCm39) P523L probably damaging Het
Myo9a A G 9: 59,802,483 (GRCm39) D1990G probably damaging Het
Niban2 T C 2: 32,809,815 (GRCm39) V304A probably benign Het
Perp C A 10: 18,731,483 (GRCm39) Y147* probably null Het
Prr16 A T 18: 51,435,755 (GRCm39) D78V probably damaging Het
Rfx7 C T 9: 72,525,228 (GRCm39) T806M probably damaging Het
Robo2 T C 16: 73,713,016 (GRCm39) probably null Het
Sema5b A T 16: 35,472,030 (GRCm39) E496V probably null Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Spdl1 T C 11: 34,710,644 (GRCm39) Y368C probably damaging Het
Sptbn2 G C 19: 4,795,921 (GRCm39) R1700P possibly damaging Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Tln2 T G 9: 67,165,848 (GRCm39) K1000Q probably damaging Het
Tmbim7 A G 5: 3,711,943 (GRCm39) T63A probably benign Het
Tmed11 T C 5: 108,926,885 (GRCm39) D129G possibly damaging Het
Ttc28 G A 5: 111,373,543 (GRCm39) S962N probably damaging Het
Ttll6 T C 11: 96,026,555 (GRCm39) I113T probably damaging Het
Uso1 T A 5: 92,318,606 (GRCm39) F210L probably damaging Het
Uspl1 T A 5: 149,131,131 (GRCm39) V224E probably benign Het
Zfp639 G A 3: 32,573,345 (GRCm39) V86I possibly damaging Het
Other mutations in Msx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02877:Msx1 APN 5 37,981,344 (GRCm39) missense possibly damaging 0.69
R1195:Msx1 UTSW 5 37,978,625 (GRCm39) missense probably damaging 1.00
R4063:Msx1 UTSW 5 37,981,365 (GRCm39) missense probably benign 0.01
R8056:Msx1 UTSW 5 37,981,544 (GRCm39) missense probably benign
R9287:Msx1 UTSW 5 37,978,795 (GRCm39) missense probably damaging 1.00
R9297:Msx1 UTSW 5 37,981,756 (GRCm39) start gained probably benign
Z1177:Msx1 UTSW 5 37,981,359 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TCTTCCCAGAAGGGGTCAGATGAG -3'
(R):5'- AGCAGTACCTGTCTATTGCCGAGC -3'

Sequencing Primer
(F):5'- GTTTAGGAAGCGACAACCAG -3'
(R):5'- AGATCTGGTTCCAGAACCGTC -3'
Posted On 2014-05-23