Incidental Mutation 'R1195:Tmed11'
ID197527
Institutional Source Beutler Lab
Gene Symbol Tmed11
Ensembl Gene ENSMUSG00000004821
Gene Nametransmembrane p24 trafficking protein 11
Synonyms1810008K16Rik
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.807) question?
Stock #R1195 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108777235-108795363 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108779019 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 129 (D129G)
Ref Sequence ENSEMBL: ENSMUSP00000004943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004943] [ENSMUST00000200159] [ENSMUST00000212176] [ENSMUST00000212212]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004943
AA Change: D129G

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000004943
Gene: ENSMUSG00000004821
AA Change: D129G

DomainStartEndE-ValueType
EMP24_GP25L 17 210 1.11e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200159
Predicted Effect probably benign
Transcript: ENSMUST00000212176
Predicted Effect probably benign
Transcript: ENSMUST00000212212
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AC073561.5 A T 12: 114,479,395 probably benign Het
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cd163 T A 6: 124,325,250 probably benign Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dab2ip T C 2: 35,718,745 probably benign Het
Dnajc25 C T 4: 59,003,415 A62V probably damaging Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Hpx A G 7: 105,599,649 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Msx1 A G 5: 37,821,281 Y297H probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Sema5b A T 16: 35,651,660 E496V probably null Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Tmed11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Tmed11 APN 5 108786165 missense probably benign 0.00
IGL01612:Tmed11 APN 5 108779884 missense possibly damaging 0.82
R0109:Tmed11 UTSW 5 108777412 missense probably damaging 1.00
R0109:Tmed11 UTSW 5 108777412 missense probably damaging 1.00
R0725:Tmed11 UTSW 5 108778989 missense probably damaging 1.00
R0836:Tmed11 UTSW 5 108795309 start codon destroyed probably null 0.47
R1195:Tmed11 UTSW 5 108779019 missense possibly damaging 0.73
R1195:Tmed11 UTSW 5 108779019 missense possibly damaging 0.73
R1551:Tmed11 UTSW 5 108779814 critical splice donor site probably null
R1815:Tmed11 UTSW 5 108777425 missense probably benign
R2004:Tmed11 UTSW 5 108786134 missense possibly damaging 0.48
R2121:Tmed11 UTSW 5 108795332 unclassified probably benign
R3116:Tmed11 UTSW 5 108779839 missense probably damaging 0.96
R4896:Tmed11 UTSW 5 108795182 splice site probably null
R5070:Tmed11 UTSW 5 108795223 missense probably benign 0.01
R5104:Tmed11 UTSW 5 108777276 utr 3 prime probably null
R5678:Tmed11 UTSW 5 108786165 missense probably benign 0.00
R6967:Tmed11 UTSW 5 108778914 missense probably damaging 1.00
Z1176:Tmed11 UTSW 5 108777320 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AGAGGCAAATGAGCCTCAATTCCC -3'
(R):5'- CTCAAGATGGTGTGGAACCTCAGTC -3'

Sequencing Primer
(F):5'- GTGAAGAAAGGTGACTCTCTCTC -3'
(R):5'- TGTGGAACCTCAGTCATGAAAG -3'
Posted On2014-05-23