Mutagenetix > Incidental Mutation

Incidental Mutation 'R1467:Cr2'

197566

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

039520-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R1467 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 195157509 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 913 (G913R)

Ref Sequence

ENSEMBL: ENSMUSP00000147804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000082321
AA Change: G537R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: G537R

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192604

Predicted Effect

probably damaging
Transcript: ENSMUST00000193356
AA Change: G240R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: G240R

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000195120
AA Change: G537R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: G537R

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195737

Predicted Effect

probably damaging
Transcript: ENSMUST00000210219
AA Change: G913R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.8889

Coding Region Coverage

1x: 97.5%
3x: 97.1%
10x: 95.9%
20x: 94.1%

Validation Efficiency

99% (104/105)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 114 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110012J17Rik	T	C	17: 66,448,327	D340G	probably damaging	Het
4930430O22Rik	T	C	5: 115,436,175		probably benign	Het
4932438A13Rik	T	A	3: 37,035,945	V676D	probably damaging	Het
A630010A05Rik	C	A	16: 14,618,583	L167I	possibly damaging	Het
Abca14	A	T	7: 120,216,182	M218L	possibly damaging	Het
Abca15	C	A	7: 120,340,538		probably null	Het
Acod1	T	C	14: 103,054,567	F176L	probably benign	Het
Actr5	A	G	2: 158,638,697	H545R	probably benign	Het
Adcy1	A	G	11: 7,138,396	T472A	probably damaging	Het
AI314180	A	G	4: 58,832,753	V869A	probably benign	Het
Aldh1l1	A	G	6: 90,571,928	K469R	possibly damaging	Het
Ambra1	A	T	2: 91,885,703	Q853L	probably damaging	Het
Apol7e	G	T	15: 77,717,766	G188V	probably damaging	Het
Atg7	T	A	6: 114,858,982		probably benign	Het
AU018091	A	T	7: 3,164,259	W43R	probably benign	Het
Baat	A	G	4: 49,503,101	V7A	probably benign	Het
Bcas1	C	A	2: 170,387,932	Q249H	possibly damaging	Het
Bptf	G	T	11: 107,055,055	Q2453K	possibly damaging	Het
Brca1	A	T	11: 101,531,107		probably benign	Het
Btg3	A	G	16: 78,364,800		probably null	Het
CAAA01180111.1	C	A	9: 124,295,463	V9L	possibly damaging	Het
Cacna2d3	T	C	14: 29,333,779	N298S	possibly damaging	Het
Carf	G	A	1: 60,127,993	V127I	possibly damaging	Het
Catsperg1	T	C	7: 29,185,008	S916G	probably damaging	Het
Cers1	T	C	8: 70,323,169	S274P	possibly damaging	Het
Ces4a	T	A	8: 105,138,035	V48E	possibly damaging	Het
Clec4e	G	A	6: 123,285,461		probably benign	Het
Cntnap5a	T	A	1: 115,685,168	L11*	probably null	Het
Cul9	A	G	17: 46,525,373	L1155P	probably damaging	Het
D130052B06Rik	C	T	11: 33,623,622		probably benign	Het
Dlec1	G	A	9: 119,128,003		probably benign	Het
Dlec1	A	T	9: 119,142,578	D1278V	probably damaging	Het
Dmrt2	A	G	19: 25,673,606	E52G	possibly damaging	Het
Dsp	A	G	13: 38,192,712	K1491R	probably benign	Het
Eef1d	A	T	15: 75,895,921	D206E	probably damaging	Het
Erbb2	C	T	11: 98,436,175	Q1137*	probably null	Het
Ercc2	T	A	7: 19,385,886	D157E	probably benign	Het
Eri1	A	G	8: 35,469,130	*346Q	probably null	Het
Espl1	A	G	15: 102,319,858	E1689G	probably benign	Het
Fam35a	G	T	14: 34,268,662	H96N	possibly damaging	Het
Fap	C	T	2: 62,517,620	V539I	probably benign	Het
Fasn	A	G	11: 120,811,040	F1871S	probably benign	Het
Gabpb1	T	G	2: 126,652,327	Y126S	probably damaging	Het
Ganc	A	T	2: 120,430,928		probably benign	Het
Gm872	T	A	10: 92,969,763	H1495L	probably benign	Het
Gm8879	C	T	5: 11,130,370	H82Y	probably damaging	Het
Gm9839	T	A	1: 32,520,513	R163*	probably null	Het
Grm1	T	C	10: 10,719,958	Y642C	probably damaging	Het
Heatr4	T	C	12: 83,978,067	T327A	possibly damaging	Het
Hmbox1	T	C	14: 64,861,578	D212G	possibly damaging	Het
Hmcn1	T	A	1: 150,689,590	D2262V	probably damaging	Het
Hoxb9	A	G	11: 96,271,938	T133A	probably benign	Het
Insr	A	T	8: 3,169,720	V934E	probably damaging	Het
Ipo9	T	C	1: 135,406,543	E315G	possibly damaging	Het
Itga10	C	T	3: 96,652,229	Q481*	probably null	Het
Kifap3	T	C	1: 163,829,120		probably benign	Het
Kntc1	T	A	5: 123,786,984	M1120K	probably benign	Het
Krt78	A	G	15: 101,946,293	Y1028H	possibly damaging	Het
Lrp1b	A	T	2: 40,657,356		probably benign	Het
Lrrc38	A	T	4: 143,369,880	I254F	probably damaging	Het
Lyrm7	A	G	11: 54,850,389	F40L	probably damaging	Het
Mfsd4b1	C	T	10: 40,002,635	S422N	possibly damaging	Het
Mlh3	A	T	12: 85,237,600	L1380*	probably null	Het
Mrpl24	C	A	3: 87,922,437	A110D	probably benign	Het
Mrps14	T	C	1: 160,196,950	V17A	probably benign	Het
Nalcn	T	C	14: 123,464,656		probably benign	Het
Neb	T	C	2: 52,230,047	Y3900C	probably damaging	Het
Neurod4	T	C	10: 130,270,604	D267G	probably benign	Het
Nf1	A	T	11: 79,428,626	I536F	possibly damaging	Het
Nkg7	C	T	7: 43,437,433	P44S	probably damaging	Het
Olfr1200	T	C	2: 88,767,488	I276V	probably benign	Het
Olfr293	T	C	7: 86,663,977	V105A	possibly damaging	Het
P3h2	A	T	16: 25,965,868		probably benign	Het
P4ha2	A	G	11: 54,106,410		probably benign	Het
Pcif1	T	C	2: 164,889,138	Y404H	probably benign	Het
Pcnx2	A	T	8: 125,753,550	L2006Q	possibly damaging	Het
Pcnx3	A	T	19: 5,674,894	S821T	possibly damaging	Het
Pde8b	T	A	13: 95,034,172	D662V	probably damaging	Het
Pkd1l3	C	T	8: 109,616,368	P113S	unknown	Het
Pkd2l1	G	T	19: 44,154,209	Q465K	possibly damaging	Het
Plch2	G	T	4: 154,983,732	P1479Q	probably benign	Het
Plekhm3	A	T	1: 64,892,882	I521N	probably damaging	Het
Pola2	A	T	19: 5,942,065	Y526*	probably null	Het
Prdm14	C	A	1: 13,124,532		probably benign	Het
Prss23	T	C	7: 89,510,009	D284G	probably damaging	Het
Psme2b	A	G	11: 48,945,640	F160S	probably damaging	Het
Rap1gap2	A	G	11: 74,437,027	V139A	possibly damaging	Het
Rbbp9	G	T	2: 144,543,857	R163S	possibly damaging	Het
Rdh12	T	C	12: 79,213,748	L206P	probably damaging	Het
Rhou	T	C	8: 123,661,290	W254R	possibly damaging	Het
Ryr3	G	T	2: 112,753,002		probably benign	Het
Scfd1	A	G	12: 51,431,498	K498E	possibly damaging	Het
Scn7a	A	G	2: 66,689,558	Y1001H	probably benign	Het
Setx	T	A	2: 29,158,905	V1981E	probably damaging	Het
Sfxn1	T	C	13: 54,093,871	I205T	possibly damaging	Het
Slc5a2	T	C	7: 128,271,256		probably benign	Het
Spock1	G	A	13: 57,429,369	R416C	possibly damaging	Het
Spred2	A	G	11: 20,018,109	I222V	probably benign	Het
Stkld1	A	T	2: 26,949,395	T358S	probably benign	Het
Strip1	T	C	3: 107,627,408	E102G	possibly damaging	Het
Tarsl2	T	C	7: 65,655,696	S223P	probably damaging	Het
Tdpoz1	T	A	3: 93,671,330	E49V	probably benign	Het
Tert	A	G	13: 73,628,209	T360A	probably benign	Het
Tspear	A	G	10: 77,881,192	Y567C	probably damaging	Het
Ttc28	A	G	5: 111,285,388	Q2096R	probably benign	Het
Ttll5	A	G	12: 85,918,962		probably null	Het
Ugt2b38	T	G	5: 87,412,373	N361H	probably damaging	Het
Vmn2r111	T	A	17: 22,571,047	H326L	probably damaging	Het
Vmn2r18	A	G	5: 151,586,836	F24S	possibly damaging	Het
Vmn2r82	A	T	10: 79,396,299	I711F	probably benign	Het
Vwa8	C	T	14: 79,103,694	Q1537*	probably null	Het
Wdr64	G	A	1: 175,775,722	V630I	probably benign	Het
Wnt6	G	T	1: 74,782,275	W84L	probably damaging	Het
Zfp11	C	A	5: 129,658,190	R69L	probably benign	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- CTCCATTTTCAACATGAACGTCTGTGC -3'
(R):5'- CCAAAATTCCTACTTTGGGTTGCGTC -3'

Sequencing Primer
(F):5'- AGCTGGGAGGGAAAGTTTAC -3'
(R):5'- agtgaagagataggagattggtg -3'

Posted On

2014-05-23