Incidental Mutation 'R0083:Tm6sf1'
ID19758
Institutional Source Beutler Lab
Gene Symbol Tm6sf1
Ensembl Gene ENSMUSG00000038623
Gene Nametransmembrane 6 superfamily member 1
SynonymsC630016D09Rik
MMRRC Submission 038370-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0083 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location81859001-81884434 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 81865345 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041890] [ENSMUST00000119543] [ENSMUST00000119543] [ENSMUST00000126334]
Predicted Effect probably null
Transcript: ENSMUST00000041890
SMART Domains Protein: ENSMUSP00000038017
Gene: ENSMUSG00000038623

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 32 54 N/A INTRINSIC
transmembrane domain 63 82 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 167 189 N/A INTRINSIC
Pfam:DUF2781 217 356 6.9e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119543
SMART Domains Protein: ENSMUSP00000112400
Gene: ENSMUSG00000038623

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
Pfam:DUF2781 126 267 9.7e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119543
SMART Domains Protein: ENSMUSP00000112400
Gene: ENSMUSG00000038623

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
Pfam:DUF2781 126 267 9.7e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124616
Predicted Effect probably benign
Transcript: ENSMUST00000126334
SMART Domains Protein: ENSMUSP00000121292
Gene: ENSMUSG00000038623

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 32 54 N/A INTRINSIC
transmembrane domain 63 82 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207657
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Ccdc88a T A 11: 29,503,463 S337T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col22a1 A T 15: 71,890,497 D104E possibly damaging Het
Col4a4 T C 1: 82,507,111 probably null Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fbxw10 A G 11: 62,877,061 T903A probably benign Het
Fkbp4 G A 6: 128,432,407 probably benign Het
Gatad2b T A 3: 90,357,943 Y576N probably damaging Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Myh14 A G 7: 44,634,519 V654A probably damaging Het
Neu2 A G 1: 87,597,262 Y323C probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Olfr1491 A T 19: 13,705,678 T284S probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sap130 C A 18: 31,666,329 probably benign Het
Sap130 C T 18: 31,711,641 P902S probably damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slc30a5 G T 13: 100,803,400 A669E probably damaging Het
Sppl2c G A 11: 104,186,532 V53I probably benign Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Sulf1 A G 1: 12,817,417 M272V probably damaging Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Tm6sf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02115:Tm6sf1 APN 7 81875803 missense probably damaging 1.00
IGL02145:Tm6sf1 APN 7 81863252 nonsense probably null
IGL02472:Tm6sf1 APN 7 81875824 splice site probably benign
IGL02862:Tm6sf1 APN 7 81870756 missense probably damaging 0.98
R0108:Tm6sf1 UTSW 7 81865345 critical splice donor site probably null
R0661:Tm6sf1 UTSW 7 81865345 critical splice donor site probably null
R3019:Tm6sf1 UTSW 7 81876065 missense probably benign 0.01
R4562:Tm6sf1 UTSW 7 81859461 missense probably damaging 1.00
R4825:Tm6sf1 UTSW 7 81865260 missense probably damaging 0.97
R4851:Tm6sf1 UTSW 7 81865343 missense probably null 1.00
R5285:Tm6sf1 UTSW 7 81859452 missense possibly damaging 0.94
R6454:Tm6sf1 UTSW 7 81876053 missense probably damaging 1.00
R7624:Tm6sf1 UTSW 7 81868710 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTGTGTAGATGACGCCCACAGAATC -3'
(R):5'- TGGTTGGTAGGGACTTCCAAAAGC -3'

Sequencing Primer
(F):5'- CAGAATCTTCTGGGACACCTAGTG -3'
(R):5'- gcttcccaaatgctgagattac -3'
Posted On2013-04-11