Incidental Mutation 'R1467:Abca14'
ID 197608
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene Name ATP-binding cassette, sub-family A member 14
Synonyms 1700110B15Rik, 4930539G24Rik
MMRRC Submission 039520-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1467 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 119803184-119924575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119815405 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 218 (M218L)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
AlphaFold E9Q8F8
Predicted Effect possibly damaging
Transcript: ENSMUST00000084640
AA Change: M218L

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: M218L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143257
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.1%
  • 10x: 95.9%
  • 20x: 94.1%
Validation Efficiency 99% (104/105)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430O22Rik T C 5: 115,574,234 (GRCm39) probably benign Het
A630010A05Rik C A 16: 14,436,447 (GRCm39) L167I possibly damaging Het
Abca15 C A 7: 119,939,761 (GRCm39) probably null Het
Acod1 T C 14: 103,292,003 (GRCm39) F176L probably benign Het
Actr5 A G 2: 158,480,617 (GRCm39) H545R probably benign Het
Adcy1 A G 11: 7,088,396 (GRCm39) T472A probably damaging Het
Aldh1l1 A G 6: 90,548,910 (GRCm39) K469R possibly damaging Het
Ambra1 A T 2: 91,716,048 (GRCm39) Q853L probably damaging Het
Apol7e G T 15: 77,601,966 (GRCm39) G188V probably damaging Het
Atg7 T A 6: 114,835,943 (GRCm39) probably benign Het
AU018091 A T 7: 3,214,089 (GRCm39) W43R probably benign Het
Baat A G 4: 49,503,101 (GRCm39) V7A probably benign Het
Bcas1 C A 2: 170,229,852 (GRCm39) Q249H possibly damaging Het
Bltp1 T A 3: 37,090,094 (GRCm39) V676D probably damaging Het
Bptf G T 11: 106,945,881 (GRCm39) Q2453K possibly damaging Het
Brca1 A T 11: 101,421,933 (GRCm39) probably benign Het
Btg3 A G 16: 78,161,688 (GRCm39) probably null Het
CAAA01180111.1 C A 9: 124,058,093 (GRCm39) V9L possibly damaging Het
Cacna2d3 T C 14: 29,055,736 (GRCm39) N298S possibly damaging Het
Carf G A 1: 60,167,152 (GRCm39) V127I possibly damaging Het
Catsperg1 T C 7: 28,884,433 (GRCm39) S916G probably damaging Het
Cers1 T C 8: 70,775,819 (GRCm39) S274P possibly damaging Het
Ces4a T A 8: 105,864,667 (GRCm39) V48E possibly damaging Het
Cfap54 T A 10: 92,805,625 (GRCm39) H1495L probably benign Het
Clec4e G A 6: 123,262,420 (GRCm39) probably benign Het
Cntnap5a T A 1: 115,612,898 (GRCm39) L11* probably null Het
Cr2 C T 1: 194,839,817 (GRCm39) G913R probably damaging Het
Cul9 A G 17: 46,836,299 (GRCm39) L1155P probably damaging Het
D130052B06Rik C T 11: 33,573,622 (GRCm39) probably benign Het
Dlec1 G A 9: 118,957,071 (GRCm39) probably benign Het
Dlec1 A T 9: 118,971,646 (GRCm39) D1278V probably damaging Het
Dmrt2 A G 19: 25,650,970 (GRCm39) E52G possibly damaging Het
Dsp A G 13: 38,376,688 (GRCm39) K1491R probably benign Het
Ecpas A G 4: 58,832,753 (GRCm39) V869A probably benign Het
Eef1d A T 15: 75,767,770 (GRCm39) D206E probably damaging Het
Erbb2 C T 11: 98,327,001 (GRCm39) Q1137* probably null Het
Ercc2 T A 7: 19,119,811 (GRCm39) D157E probably benign Het
Eri1 A G 8: 35,936,284 (GRCm39) *346Q probably null Het
Espl1 A G 15: 102,228,293 (GRCm39) E1689G probably benign Het
Fap C T 2: 62,347,964 (GRCm39) V539I probably benign Het
Fasn A G 11: 120,701,866 (GRCm39) F1871S probably benign Het
Gabpb1 T G 2: 126,494,247 (GRCm39) Y126S probably damaging Het
Ganc A T 2: 120,261,409 (GRCm39) probably benign Het
Gm9839 T A 1: 32,559,594 (GRCm39) R163* probably null Het
Grm1 T C 10: 10,595,702 (GRCm39) Y642C probably damaging Het
Heatr4 T C 12: 84,024,841 (GRCm39) T327A possibly damaging Het
Hmbox1 T C 14: 65,099,027 (GRCm39) D212G possibly damaging Het
Hmcn1 T A 1: 150,565,341 (GRCm39) D2262V probably damaging Het
Hoxb9 A G 11: 96,162,764 (GRCm39) T133A probably benign Het
Insr A T 8: 3,219,720 (GRCm39) V934E probably damaging Het
Ipo9 T C 1: 135,334,281 (GRCm39) E315G possibly damaging Het
Itga10 C T 3: 96,559,545 (GRCm39) Q481* probably null Het
Kifap3 T C 1: 163,656,689 (GRCm39) probably benign Het
Kntc1 T A 5: 123,925,047 (GRCm39) M1120K probably benign Het
Krt78 A G 15: 101,854,728 (GRCm39) Y1028H possibly damaging Het
Lrp1b A T 2: 40,547,368 (GRCm39) probably benign Het
Lrrc38 A T 4: 143,096,450 (GRCm39) I254F probably damaging Het
Lyrm7 A G 11: 54,741,215 (GRCm39) F40L probably damaging Het
Mfsd4b1 C T 10: 39,878,631 (GRCm39) S422N possibly damaging Het
Mlh3 A T 12: 85,284,374 (GRCm39) L1380* probably null Het
Mrpl24 C A 3: 87,829,744 (GRCm39) A110D probably benign Het
Mrps14 T C 1: 160,024,520 (GRCm39) V17A probably benign Het
Mtcl1 T C 17: 66,755,322 (GRCm39) D340G probably damaging Het
Nalcn T C 14: 123,702,068 (GRCm39) probably benign Het
Neb T C 2: 52,120,059 (GRCm39) Y3900C probably damaging Het
Neurod4 T C 10: 130,106,473 (GRCm39) D267G probably benign Het
Nf1 A T 11: 79,319,452 (GRCm39) I536F possibly damaging Het
Nkg7 C T 7: 43,086,857 (GRCm39) P44S probably damaging Het
Or14c40 T C 7: 86,313,185 (GRCm39) V105A possibly damaging Het
Or4a67 T C 2: 88,597,832 (GRCm39) I276V probably benign Het
P3h2 A T 16: 25,784,618 (GRCm39) probably benign Het
P4ha2 A G 11: 53,997,236 (GRCm39) probably benign Het
Pcif1 T C 2: 164,731,058 (GRCm39) Y404H probably benign Het
Pcnx2 A T 8: 126,480,289 (GRCm39) L2006Q possibly damaging Het
Pcnx3 A T 19: 5,724,922 (GRCm39) S821T possibly damaging Het
Pde8b T A 13: 95,170,680 (GRCm39) D662V probably damaging Het
Pkd1l3 C T 8: 110,343,000 (GRCm39) P113S unknown Het
Pkd2l1 G T 19: 44,142,648 (GRCm39) Q465K possibly damaging Het
Plch2 G T 4: 155,068,189 (GRCm39) P1479Q probably benign Het
Plekhm3 A T 1: 64,932,041 (GRCm39) I521N probably damaging Het
Pola2 A T 19: 5,992,093 (GRCm39) Y526* probably null Het
Prdm14 C A 1: 13,194,756 (GRCm39) probably benign Het
Prss23 T C 7: 89,159,217 (GRCm39) D284G probably damaging Het
Psme2b A G 11: 48,836,467 (GRCm39) F160S probably damaging Het
Rap1gap2 A G 11: 74,327,853 (GRCm39) V139A possibly damaging Het
Rbbp9 G T 2: 144,385,777 (GRCm39) R163S possibly damaging Het
Rdh12 T C 12: 79,260,522 (GRCm39) L206P probably damaging Het
Rhou T C 8: 124,388,029 (GRCm39) W254R possibly damaging Het
Ryr3 G T 2: 112,583,347 (GRCm39) probably benign Het
Scfd1 A G 12: 51,478,281 (GRCm39) K498E possibly damaging Het
Scn7a A G 2: 66,519,902 (GRCm39) Y1001H probably benign Het
Setx T A 2: 29,048,917 (GRCm39) V1981E probably damaging Het
Sfxn1 T C 13: 54,247,890 (GRCm39) I205T possibly damaging Het
Shld2 G T 14: 33,990,619 (GRCm39) H96N possibly damaging Het
Slc5a2 T C 7: 127,870,428 (GRCm39) probably benign Het
Speer1g C T 5: 11,180,337 (GRCm39) H82Y probably damaging Het
Spock1 G A 13: 57,577,182 (GRCm39) R416C possibly damaging Het
Spred2 A G 11: 19,968,109 (GRCm39) I222V probably benign Het
Stkld1 A T 2: 26,839,407 (GRCm39) T358S probably benign Het
Strip1 T C 3: 107,534,724 (GRCm39) E102G possibly damaging Het
Tars3 T C 7: 65,305,444 (GRCm39) S223P probably damaging Het
Tdpoz1 T A 3: 93,578,637 (GRCm39) E49V probably benign Het
Tert A G 13: 73,776,328 (GRCm39) T360A probably benign Het
Tspear A G 10: 77,717,026 (GRCm39) Y567C probably damaging Het
Ttc28 A G 5: 111,433,254 (GRCm39) Q2096R probably benign Het
Ttll5 A G 12: 85,965,736 (GRCm39) probably null Het
Ugt2b38 T G 5: 87,560,232 (GRCm39) N361H probably damaging Het
Vmn2r111 T A 17: 22,790,028 (GRCm39) H326L probably damaging Het
Vmn2r18 A G 5: 151,510,301 (GRCm39) F24S possibly damaging Het
Vmn2r82 A T 10: 79,232,133 (GRCm39) I711F probably benign Het
Vwa8 C T 14: 79,341,134 (GRCm39) Q1537* probably null Het
Wdr64 G A 1: 175,603,288 (GRCm39) V630I probably benign Het
Wnt6 G T 1: 74,821,434 (GRCm39) W84L probably damaging Het
Zfp11 C A 5: 129,735,254 (GRCm39) R69L probably benign Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 119,846,076 (GRCm39) missense probably damaging 1.00
IGL00800:Abca14 APN 7 119,854,613 (GRCm39) missense probably benign 0.01
IGL00845:Abca14 APN 7 119,823,174 (GRCm39) splice site probably benign
IGL00897:Abca14 APN 7 119,815,348 (GRCm39) splice site probably benign
IGL01524:Abca14 APN 7 119,852,644 (GRCm39) missense possibly damaging 0.57
IGL01747:Abca14 APN 7 119,877,310 (GRCm39) missense probably benign 0.00
IGL02214:Abca14 APN 7 119,893,398 (GRCm39) missense probably benign 0.09
IGL02215:Abca14 APN 7 119,852,612 (GRCm39) missense probably benign 0.00
IGL02253:Abca14 APN 7 119,807,182 (GRCm39) missense probably benign 0.29
IGL02302:Abca14 APN 7 119,917,968 (GRCm39) splice site probably benign
IGL03391:Abca14 APN 7 119,846,107 (GRCm39) missense probably damaging 1.00
F6893:Abca14 UTSW 7 119,924,261 (GRCm39) missense probably damaging 0.98
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0265:Abca14 UTSW 7 119,822,850 (GRCm39) missense probably benign 0.03
R0326:Abca14 UTSW 7 119,823,642 (GRCm39) missense probably damaging 1.00
R0380:Abca14 UTSW 7 119,877,703 (GRCm39) missense probably benign 0.03
R0418:Abca14 UTSW 7 119,806,657 (GRCm39) missense probably damaging 1.00
R0539:Abca14 UTSW 7 119,807,020 (GRCm39) missense probably damaging 1.00
R0574:Abca14 UTSW 7 119,823,720 (GRCm39) missense probably damaging 0.96
R0611:Abca14 UTSW 7 119,851,479 (GRCm39) missense possibly damaging 0.63
R0783:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0785:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0863:Abca14 UTSW 7 119,815,453 (GRCm39) missense probably benign 0.03
R1034:Abca14 UTSW 7 119,815,370 (GRCm39) missense probably damaging 1.00
R1056:Abca14 UTSW 7 119,924,295 (GRCm39) missense probably damaging 1.00
R1072:Abca14 UTSW 7 119,811,992 (GRCm39) missense probably benign
R1244:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1255:Abca14 UTSW 7 119,807,016 (GRCm39) missense probably damaging 0.97
R1271:Abca14 UTSW 7 119,924,340 (GRCm39) missense probably damaging 1.00
R1325:Abca14 UTSW 7 119,846,545 (GRCm39) missense probably benign 0.32
R1457:Abca14 UTSW 7 119,888,683 (GRCm39) missense probably benign 0.00
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1494:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R1551:Abca14 UTSW 7 119,918,101 (GRCm39) missense probably benign 0.10
R1607:Abca14 UTSW 7 119,850,514 (GRCm39) missense probably damaging 1.00
R1739:Abca14 UTSW 7 119,877,529 (GRCm39) missense probably benign 0.04
R1856:Abca14 UTSW 7 119,877,404 (GRCm39) missense probably damaging 1.00
R1875:Abca14 UTSW 7 119,847,190 (GRCm39) missense possibly damaging 0.78
R1892:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1898:Abca14 UTSW 7 119,850,392 (GRCm39) missense probably damaging 1.00
R1958:Abca14 UTSW 7 119,924,382 (GRCm39) missense probably damaging 0.98
R2018:Abca14 UTSW 7 119,815,408 (GRCm39) missense probably benign 0.00
R2039:Abca14 UTSW 7 119,911,487 (GRCm39) missense probably damaging 0.98
R2060:Abca14 UTSW 7 119,826,741 (GRCm39) nonsense probably null
R2202:Abca14 UTSW 7 119,888,764 (GRCm39) missense probably benign 0.17
R2205:Abca14 UTSW 7 119,846,503 (GRCm39) missense probably damaging 0.98
R2360:Abca14 UTSW 7 119,850,431 (GRCm39) missense probably benign 0.00
R2401:Abca14 UTSW 7 119,882,312 (GRCm39) missense probably damaging 1.00
R2426:Abca14 UTSW 7 119,882,446 (GRCm39) missense probably benign 0.04
R3433:Abca14 UTSW 7 119,893,455 (GRCm39) missense probably damaging 0.97
R4598:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4599:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4700:Abca14 UTSW 7 119,911,928 (GRCm39) critical splice donor site probably null
R4751:Abca14 UTSW 7 119,911,400 (GRCm39) missense probably benign 0.01
R4826:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4828:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4837:Abca14 UTSW 7 119,846,203 (GRCm39) missense probably benign
R4881:Abca14 UTSW 7 119,877,472 (GRCm39) missense possibly damaging 0.49
R4895:Abca14 UTSW 7 119,846,572 (GRCm39) critical splice donor site probably null
R4928:Abca14 UTSW 7 119,923,803 (GRCm39) missense possibly damaging 0.90
R4990:Abca14 UTSW 7 119,911,388 (GRCm39) missense probably benign 0.00
R5027:Abca14 UTSW 7 119,911,505 (GRCm39) missense probably benign 0.05
R5091:Abca14 UTSW 7 119,851,497 (GRCm39) missense probably damaging 1.00
R5158:Abca14 UTSW 7 119,852,652 (GRCm39) missense probably benign
R5209:Abca14 UTSW 7 119,832,130 (GRCm39) missense probably benign 0.01
R5333:Abca14 UTSW 7 119,888,769 (GRCm39) nonsense probably null
R5424:Abca14 UTSW 7 119,810,777 (GRCm39) missense probably benign 0.01
R5488:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5489:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5716:Abca14 UTSW 7 119,846,217 (GRCm39) critical splice donor site probably null
R6450:Abca14 UTSW 7 119,815,449 (GRCm39) missense probably benign 0.17
R6477:Abca14 UTSW 7 119,924,325 (GRCm39) missense probably benign 0.44
R6652:Abca14 UTSW 7 119,846,164 (GRCm39) missense probably damaging 1.00
R6782:Abca14 UTSW 7 119,847,308 (GRCm39) missense probably damaging 1.00
R6874:Abca14 UTSW 7 119,851,428 (GRCm39) missense possibly damaging 0.71
R6965:Abca14 UTSW 7 119,882,452 (GRCm39) nonsense probably null
R7142:Abca14 UTSW 7 119,850,406 (GRCm39) missense possibly damaging 0.89
R7146:Abca14 UTSW 7 119,854,520 (GRCm39) missense probably benign 0.15
R7202:Abca14 UTSW 7 119,917,236 (GRCm39) missense probably damaging 1.00
R7220:Abca14 UTSW 7 119,826,667 (GRCm39) missense possibly damaging 0.45
R7241:Abca14 UTSW 7 119,846,184 (GRCm39) missense probably damaging 1.00
R7291:Abca14 UTSW 7 119,888,832 (GRCm39) nonsense probably null
R7296:Abca14 UTSW 7 119,877,534 (GRCm39) missense probably benign
R7298:Abca14 UTSW 7 119,807,106 (GRCm39) missense probably benign 0.00
R7315:Abca14 UTSW 7 119,893,341 (GRCm39) missense probably benign 0.00
R7776:Abca14 UTSW 7 119,832,214 (GRCm39) critical splice donor site probably null
R7820:Abca14 UTSW 7 119,811,944 (GRCm39) missense probably benign 0.42
R7873:Abca14 UTSW 7 119,888,792 (GRCm39) missense probably benign 0.17
R8215:Abca14 UTSW 7 119,893,425 (GRCm39) missense probably benign
R8332:Abca14 UTSW 7 119,815,436 (GRCm39) missense probably benign
R8419:Abca14 UTSW 7 119,815,489 (GRCm39) missense probably benign 0.08
R8444:Abca14 UTSW 7 119,918,133 (GRCm39) missense probably damaging 1.00
R8818:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R8834:Abca14 UTSW 7 119,877,372 (GRCm39) missense probably benign 0.02
R8845:Abca14 UTSW 7 119,846,428 (GRCm39) missense probably benign 0.00
R8889:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8892:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8894:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably damaging 1.00
R8903:Abca14 UTSW 7 119,815,526 (GRCm39) missense probably damaging 0.98
R8950:Abca14 UTSW 7 119,823,595 (GRCm39) missense possibly damaging 0.92
R8950:Abca14 UTSW 7 119,823,644 (GRCm39) nonsense probably null
R9018:Abca14 UTSW 7 119,918,532 (GRCm39) missense probably damaging 0.98
R9018:Abca14 UTSW 7 119,888,763 (GRCm39) missense probably benign 0.01
R9110:Abca14 UTSW 7 119,831,615 (GRCm39) intron probably benign
R9254:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9376:Abca14 UTSW 7 119,893,438 (GRCm39) missense probably damaging 1.00
R9378:Abca14 UTSW 7 119,807,191 (GRCm39) missense possibly damaging 0.64
R9379:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9388:Abca14 UTSW 7 119,882,261 (GRCm39) missense probably benign 0.01
R9445:Abca14 UTSW 7 119,877,691 (GRCm39) missense probably benign 0.05
R9522:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably null 0.98
R9577:Abca14 UTSW 7 119,810,768 (GRCm39) missense probably benign 0.27
R9627:Abca14 UTSW 7 119,854,530 (GRCm39) missense probably benign 0.00
R9639:Abca14 UTSW 7 119,893,345 (GRCm39) missense probably benign 0.01
R9660:Abca14 UTSW 7 119,851,478 (GRCm39) missense probably benign 0.00
R9696:Abca14 UTSW 7 119,888,734 (GRCm39) missense possibly damaging 0.59
R9709:Abca14 UTSW 7 119,888,739 (GRCm39) nonsense probably null
R9780:Abca14 UTSW 7 119,911,447 (GRCm39) missense probably benign 0.00
Z1088:Abca14 UTSW 7 119,815,358 (GRCm39) missense probably benign 0.14
Z1176:Abca14 UTSW 7 119,846,146 (GRCm39) missense probably damaging 1.00
Z1177:Abca14 UTSW 7 119,917,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGAACTTGACAGTCTCTGGTTTTG -3'
(R):5'- GAAAATTGATCGTTGGCCCTGTGC -3'

Sequencing Primer
(F):5'- ACAGTCTCTGgttttgttttattttg -3'
(R):5'- CCCACAGGATGTCTATTTAGCAGAG -3'
Posted On 2014-05-23